how to use samtools to get consensus sequence?
see #2
edited.
edited.
-
-
my command line:
samtools mpileup -uf [ref] [aln.bam] | /bcftools/bcftools view -cg - | /bcftools/vcfutils.pl vcf2fq > [result.fq]
the result shows :
@gi|110645304|ref|NC_002516.2|
GCGTCGGCCTGGGCAAGACCCACCTGATGCATGCGGTGGGCAACCACCTGCTGAAGAAGA
ACCCGAACGCCAAGGTGGTTTACCTGCATTCGGAACGTTTCGTCGCGGACATGGTGAAGG
+
....
i want to split the consensus seq to contigs at the point with 0-coverage. how may i determine the coverage of each base in the file?
and i dont want any ambiguous base, is that possible to play with parameters to achieve that? what does N or n mean in the sequence? is that gaps or 0-coverage?
thx for reply!
-
NGS has revolutionized clinical microbiology by offering new ways to identify and surveil pathogens without prior knowledge of the target. One popular approach is 16S rRNA and ITS amplicon sequencing, which targets specific microbial markers. But studies are increasingly incorporating shotgun metagenomics, a technique that sequences all DNA from a sample without targeting specific microbial markers. This approach allows more detailed taxonomic classification, detection...Yesterday, 06:46 AM -
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM
Comment