Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • mmartin
    Member
    • Aug 2009
    • 73

    #46
    How would the masking look like? I imagine lowercase vs. uppercase would be an option. Could you please add this as a feature request to the issue tracker on http://cutadapt.googlecode.com/ ?

    Comment

    • lmilne
      Junior Member
      • Apr 2009
      • 8

      #47
      Masking with 'N' would work for me.

      Comment

      • kbhit
        Junior Member
        • Sep 2011
        • 9

        #48
        What's the best way to cutadapt Illumina reads where there are 2 adaptors such as:
        5' - adaptor1 - sequence - adaptor2 - 3'

        I want to the adaptors on both sides. What I have been doing is running cutadapt twice:
        a. Run cut-adapt with -a flag with adaptor2
        b. Feed the above output to another cut-adapt with -g flag of adaptor1

        Is that the best method to handle cutting both the adaptors?

        Many thanks,
        Phillipe

        Comment

        • chjiao
          Junior Member
          • Aug 2011
          • 2

          #49
          A very good and valuable tool to cut adaptors from SOLiD sequencing data, but I wish that you could make the 5' adaptors cut for color-space data, since in the situation when Adaptors connected to another Adaptors this function is necessary.

          Comment

          • mmartin
            Member
            • Aug 2009
            • 73

            #50
            Originally posted by chjiao View Post
            but I wish that you could make the 5' adaptors cut for color-space data, since in the situation when Adaptors connected to another Adaptors this function is necessary.
            I have just released cutadapt 1.1, which adds this feature and is also 30% faster than before. See the release announcement at http://code.google.com/p/cutadapt/

            Comment

            • mmartin
              Member
              • Aug 2009
              • 73

              #51
              Originally posted by kbhit View Post
              What's the best way to cutadapt Illumina reads where there are 2 adaptors such as:
              5' - adaptor1 - sequence - adaptor2 - 3'

              I want to the adaptors on both sides. What I have been doing is running cutadapt twice:
              a. Run cut-adapt with -a flag with adaptor2
              b. Feed the above output to another cut-adapt with -g flag of adaptor1

              Is that the best method to handle cutting both the adaptors?
              Yes, that is currently the best way to handle this kind of data. There's also an open feature request regarding some kind of 'paired adapter' mode, but this isn't implemented, yet.

              Comment

              • chjiao
                Junior Member
                • Aug 2011
                • 2

                #52
                Originally posted by mmartin View Post
                I have just released cutadapt 1.1, which adds this feature and is also 30% faster than before. See the release announcement at http://code.google.com/p/cutadapt/
                Thanks, the new version of cutadap is challening when dealing with color-sapce data.

                Comment

                • kerhard
                  Member
                  • Feb 2011
                  • 27

                  #53
                  cutadapt trimming length issue

                  Hi all,

                  I just used cutadapt to process some libraries I made and got a result that I don't quite understand. It appears that cutadapt trimmed more than 21 bases (the length of the adapter sequence) from many of the reads. I would think that the longest length that cutadapt could trim from the reads would be 21 bp if given a 21 bp-long adapter. Here is my output:

                  $ cutadapt -q 20 --quality-base=64 -a TCGTATGCCGTCTTCTGCTTG wt.fastq -o wt_adapttrim.fastq
                  cutadapt version 1.1
                  Command line parameters: -q 20 --quality-base=64 -a TCGTATGCCGTCTTCTGCTTG wt.fastq -o wt_adapttrim.fastq
                  Maximum error rate: 10.00%
                  Processed reads: 54310589
                  Trimmed reads: 8911163 ( 16.4%)
                  Total basepairs: 2111179389 (2111.2 Mbp)
                  Trimmed basepairs: 100971255 (101.0 Mbp) (4.78% of total)
                  Too short reads: 0 ( 0.0% of processed reads)
                  Too long reads: 0 ( 0.0% of processed reads)
                  Total time: 1918.18 s
                  Time per read: 0.04 ms

                  === Adapter 1 ===

                  Adapter 'TCGTATGCCGTCTTCTGCTTG', length 21, was trimmed 8911163 times.

                  Lengths of removed sequences
                  length count expected
                  3 1088578 848603.0
                  4 735568 212150.7
                  5 672468 53037.7
                  6 645706 13259.4
                  7 570424 3314.9
                  8 507225 828.7
                  9 449549 207.2
                  10 387252 51.8
                  11 320108 12.9
                  12 298280 3.2
                  13 277658 0.8
                  14 277521 0.2
                  15 244603 0.1
                  16 239725 0.0
                  17 202783 0.0
                  18 205865 0.0
                  19 202092 0.0
                  20 233860 0.0
                  21 208748 0.0
                  22 136163 0.0
                  >=23 1006987 0.0


                  Any answers would be greatly appreciated!

                  This tool is super and very intuitive, thank you for it.
                  Last edited by kerhard; 08-07-2012, 08:23 PM. Reason: no title

                  Comment

                  • kerhard
                    Member
                    • Feb 2011
                    • 27

                    #54
                    Originally posted by kerhard View Post
                    Hi all,

                    I just used cutadapt to process some libraries I made and got a result that I don't quite understand. It appears that cutadapt trimmed more than 21 bases (the length of the adapter sequence) from many of the reads. I would think that the longest length that cutadapt could trim from the reads would be 21 bp if given a 21 bp-long adapter. Here is my output:

                    $ cutadapt -q 20 --quality-base=64 -a TCGTATGCCGTCTTCTGCTTG wt.fastq -o wt_adapttrim.fastq
                    cutadapt version 1.1
                    Command line parameters: -q 20 --quality-base=64 -a TCGTATGCCGTCTTCTGCTTG wt.fastq -o wt_adapttrim.fastq
                    Maximum error rate: 10.00%
                    Processed reads: 54310589
                    Trimmed reads: 8911163 ( 16.4%)
                    Total basepairs: 2111179389 (2111.2 Mbp)
                    Trimmed basepairs: 100971255 (101.0 Mbp) (4.78% of total)
                    Too short reads: 0 ( 0.0% of processed reads)
                    Too long reads: 0 ( 0.0% of processed reads)
                    Total time: 1918.18 s
                    Time per read: 0.04 ms

                    === Adapter 1 ===

                    Adapter 'TCGTATGCCGTCTTCTGCTTG', length 21, was trimmed 8911163 times.

                    Lengths of removed sequences
                    length count expected
                    3 1088578 848603.0
                    4 735568 212150.7
                    5 672468 53037.7
                    6 645706 13259.4
                    7 570424 3314.9
                    8 507225 828.7
                    9 449549 207.2
                    10 387252 51.8
                    11 320108 12.9
                    12 298280 3.2
                    13 277658 0.8
                    14 277521 0.2
                    15 244603 0.1
                    16 239725 0.0
                    17 202783 0.0
                    18 205865 0.0
                    19 202092 0.0
                    20 233860 0.0
                    21 208748 0.0
                    22 136163 0.0
                    >=23 1006987 0.0


                    Any answers would be greatly appreciated!

                    This tool is super and very intuitive, thank you for it.
                    Sorry, I wasn't reading the description of the options carefully enough. I think I understand now what the above results indicate. Using the -a option and given an adapter 21 bp in length, a longer length than 21 bp would be trimmed by cutadapt from a given read if the adapter was found in the 5' end of the read, followed by more sequence.

                    If someone could verify if this is the case, or whether I am missing some other reason, it would be much appreciated.

                    Comment

                    • mmartin
                      Member
                      • Aug 2009
                      • 73

                      #55
                      Originally posted by kerhard View Post
                      Sorry, I wasn't reading the description of the options carefully enough. I think I understand now what the above results indicate. Using the -a option and given an adapter 21 bp in length, a longer length than 21 bp would be trimmed by cutadapt from a given read if the adapter was found in the 5' end of the read, followed by more sequence.

                      If someone could verify if this is the case, or whether I am missing some other reason, it would be much appreciated.
                      Yes, that is correct. The column indicates the length of the removed sequence, which includes the bases after the adapter if there are any. It used to indicate the length of the matching adapter in earlier cutadapt versions, but I think that was less helpful.

                      Comment

                      • kerhard
                        Member
                        • Feb 2011
                        • 27

                        #56
                        Originally posted by mmartin View Post
                        Yes, that is correct. The column indicates the length of the removed sequence, which includes the bases after the adapter if there are any. It used to indicate the length of the matching adapter in earlier cutadapt versions, but I think that was less helpful.

                        Thanks for confirmation. I'm glad I tried out cutadapt, as I was assuming my libraries were absent of adapter sequences, which turns out not to be true at all.

                        I suppose I still don't understand how some of these reads can have sequence AFTER the 3' adapters (eg., adapters found in the middle of the read). Searching for the full adapter sequence in the raw read files by hand, I notice that many times the sequences found after the 3' adapter are a string of A's. For example:

                        AGTCTADAPTERAAAAAAAAAAAA

                        TGCGTACGRACTADAPTERAAAAA

                        Any ideas as to what that means and how that may happen? Are these from the sequencing reactions on the Illumina machines or are these from library constructions?

                        Comment

                        • mmartin
                          Member
                          • Aug 2009
                          • 73

                          #57
                          Originally posted by kerhard View Post
                          Any ideas as to what that means and how that may happen? Are these from the sequencing reactions on the Illumina machines or are these from library constructions?
                          I cannot really tell because I haven’t seen that before - but I mostly work with SOLiD data, so that doesn’t mean anything. You could look at the qualities that were assigned to the ”A“s. I would guess that they are from the library construction if the qualities are high, but that they are artifacts from the sequencing process if the qualities are low.

                          On further thought, I would also expect that artifacts from the sequencing process (the basecaller calling a base although there really is none) would lead to a sequence of random nucleotides, but I’m only speculating here.

                          Comment

                          • rimpi
                            Junior Member
                            • Apr 2012
                            • 2

                            #58
                            Can Cutadapt give the results in csfasta format.
                            I have solid data and I used cutadapt for removing the adapters in colorspace but there is an option of removing the adapters and then the resultant file in fastq format. can't I get it in csfasta format.
                            Here is the result of cutadaptIs it correct)
                            Command line parameters: -c -e 0.12 -a 330201030313112312 -x abc: --maq -o output.fastq /home/rimpi/solid/hubert/mergecs/1A.csfasta /home/rimpi/solid/hubert/mergecs/1A_QV.qual
                            Maximum error rate: 12.00%
                            Processed reads: 35052447
                            Trimmed reads: 23518246 ( 67.1%)
                            Total basepairs: 2593881078 (2593.9 Mbp)
                            Trimmed basepairs: 881159025 (881.2 Mbp) (33.97% of total)
                            Too short reads: 0 ( 0.0% of processed reads)
                            Too long reads: 0 ( 0.0% of processed reads)
                            Total time: 3386.48 s
                            Time per read: 0.10 ms

                            === Adapter 1 ===

                            Adapter '330201030313112312', length 18, was trimmed 23518246 times.

                            Lengths of removed sequences
                            length count expected
                            3 294756 547694.5
                            4 122284 136923.6
                            5 155337 34230.9
                            6 196812 8557.7
                            7 260390 2139.4
                            8 318801 534.9
                            9 772603 133.7
                            10 419888 33.4
                            11 140579 8.4
                            12 214331 2.1
                            13 229820 0.5
                            14 456111 0.1
                            15 120289 0.0
                            16 107822 0.0
                            17 169000 0.0
                            18 235124 0.0
                            19 206157 0.0
                            >=20 19098142 0.0

                            Comment

                            • mmartin
                              Member
                              • Aug 2009
                              • 73

                              #59
                              Sorry, csfasta/qual output is not supported at the moment. You will have to use a separate program to convert colorspace FASTQ to csfasta/qual (I think someone posted one in the forum). Don't use the --maq option if you do that. Which read mapper do you use that does not support colorspace FASTQ?

                              Comment

                              • minoru_harvest
                                Junior Member
                                • Aug 2012
                                • 5

                                #60
                                s silly question:
                                how can i pipeline cutadapt with other program ? cutadapt seems not being able to read from STDIN, so i cannot use "|"?

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Yesterday, 10:13 AM
                                0 responses
                                13 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-31-2026, 02:55 AM
                                0 responses
                                26 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                20 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                19 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...