Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Giorgio C
    Member
    • Oct 2010
    • 89

    #1

    Blast > parsing result in Exel

    Hy everybody,

    in this situation froma blast (-m 1) result file :

    Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
    Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
    "Gapped BLAST and PSI-BLAST: a new generation of protein database search
    programs", Nucleic Acids Res. 25:3389-3402.

    Query= 132-291
    (59 letters)

    Database: Scrivania/orchidea/mature_mirBase.fa
    21,643 sequences; 470,608 total letters

    Searching..................................................done



    Score E
    Sequences producing significant alignments: (bits) Value

    mtr-miR2644b MIMAT0013413 Medicago truncatula miR2644b 28 0.031
    mtr-miR2644a MIMAT0013412 Medicago truncatula miR2644a 28 0.031
    gga-miR-1704 MIMAT0007596 Gallus gallus miR-1704 22 1.9
    gga-miR-1557 MIMAT0007414 Gallus gallus miR-1557 22 1.9
    mmu-miR-880-5p MIMAT0017266 Mus musculus miR-880-5p 22 1.9

    132_0 8 cagccgctcagattgatggtgcctacagccttgccagcccgctcagattgat 59
    12631 5 .............. 18
    12630 5 .............. 18
    7826 5 ........... 15
    7644 19 ........... 9
    5394 3 ........... 13
    5394 3 ........... 13
    BLASTN 2.2.21 [Jun-14-2009]


    Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
    ...
    ....
    ..........

    ______________________________________________________________
    I need to parse in an exel sheet :

    1)ID 2)Name of the hit 3)E-value 4)Score 5)Species


    1) 132-291 2)mir2644b 3) 0,031 4)28 5) Medicago truncatula


    Is possible from a big blast result file obtain an exel with 5 columns where every field is the first hit of the blast result. Can anyone halp me to fix this problem ??? Also with a little script in perl.


    Thank you very much
  • NicoBxl
    not just another member
    • Aug 2010
    • 264

    #2
    use -m 8 for tabular output and then import in excel

    Comment

    • Giorgio C
      Member
      • Oct 2010
      • 89

      #3
      I know the -m 8 view but give me another result respect to m1 with lack of information. So i ask you a little script to handle the txt file and parse it on exel.

      Comment

      • maubp
        Peter (Biopython etc)
        • Jul 2009
        • 1544

        #4
        You really don't want to try and use Excel for parsing plain text BLAST output. Parsing plain text BLAST output is annoying enough in a proper language like Perl or Python - BioPerl, Biopython and the NCBI don't recommend it. Rather they recommend to use the tabular output (simpler) or the XML ouput (richer).

        Note BLAST+ lets you request quite a lot of extra columns of information in the tabular output. If that still isn't enough, I would write a script (not using Excel) to parse the extra information from the XML BLAST output.

        In fact, you really shouldn't want to use Excel for Bioinformatics in the first place. One very nicely documented reason is here http://dx.doi.org/10.1186/1471-2105-5-80
        Last edited by maubp; 11-15-2011, 04:57 AM. Reason: Note about BLAST+ extra columns in tabular output; recommendation

        Comment

        • Giorgio C
          Member
          • Oct 2010
          • 89

          #5
          Thanks you very much, i did not know about this limit, i'll read the paper.

          Cheers

          Comment

          • maubp
            Peter (Biopython etc)
            • Jul 2009
            • 1544

            #6
            I see you're opting for Perl, in which case using BioPerl to parse the BLAST text output is a very good idea: http://lists.open-bio.org/pipermail/...er/035872.html

            Comment

            • Giorgio C
              Member
              • Oct 2010
              • 89

              #7
              Yes, infact !!! Thanks you very much !!!

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                New Genomics Technologies Take Aim at Long-Standing Limits
                by SEQadmin2


                Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

                We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
                ...
                Yesterday, 10:25 AM
              • SEQadmin2
                How Immunogenomics Decodes Immunity’s Genetic Blueprint
                by SEQadmin2




                The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                This convergence of genetics, immunology, and computation...
                09-01-2026, 05:41 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 09-25-2026, 09:06 AM
              0 responses
              28 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 09-23-2026, 11:05 AM
              0 responses
              24 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 09-18-2026, 11:37 AM
              1 response
              46 views
              0 reactions
              Last Post pekgio
              by pekgio
               
              Started by SEQadmin2, 09-16-2026, 10:23 AM
              1 response
              55 views
              0 reactions
              Last Post pekgio
              by pekgio
               
              Working...