Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • ein_io
    Member
    • Nov 2011
    • 14

    PE sequencing of a lib with ONE end high and the other low complexity

    I am preparing a custom library for paired end sequencing.

    It is a low complexity lib. To circumvent the problem with cluster calling I have included NNNNN from the end that will be sequenced first (right after the ACACTCTTTCCCTACACGACGCTCTTCCGATCT which I assume is used for the first read)

    I wonder whether I need to put NNNNN on the other side as well? Does the reverse read use the cluster positional information generated during the first read?

    any thoughts - deeply appreciated

  • HESmith
    Senior Member
    • Oct 2009
    • 512

    #2
    Try searching the forum; this issue has been addressed multiple times.

    Comment

    • ein_io
      Member
      • Nov 2011
      • 14

      #3
      tried searching the forum - found it mentioned once (in a thread discussing the bareback "delayed" cluster calling one guy says that clusters are not called during the reverse PE run) but not discussed explicitly

      if you know the answer - can you tell me?

      Comment

      • pmiguel
        Senior Member
        • Aug 2008
        • 2328

        #4
        Originally posted by ein_io View Post
        I am preparing a custom library for paired end sequencing.

        It is a low complexity lib. To circumvent the problem with cluster calling I have included NNNNN from the end that will be sequenced first (right after the ACACTCTTTCCCTACACGACGCTCTTCCGATCT which I assume is used for the first read)

        I wonder whether I need to put NNNNN on the other side as well? Does the reverse read use the cluster positional information generated during the first read?
        Yes, the reverse read uses the cluster positions generated during the first read.

        That said, I have noticed focus issues that seem to spring up when the instrument attempts a scan with no clusters fluorescing. (During the indexing cycles in my case.) My concern would be this would be especially an issue during the first few cycles of a read. Recent firmware upgrades have ameliorated this issue. But it still makes me nervous. But I think the instrument we have, the HiScanSQ, may be more susceptible to this issue than the more common HiSeqs.

        Sacrificing those first 5 bases of your reverse read: I can't say it is worth it, but maybe.

        --
        Phillip

        Comment

        • ein_io
          Member
          • Nov 2011
          • 14

          #5
          Thank you very much, Phillip

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 07-24-2026, 12:17 PM
          0 responses
          16 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-23-2026, 11:41 AM
          0 responses
          18 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-20-2026, 11:10 AM
          0 responses
          24 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-13-2026, 10:26 AM
          0 responses
          37 views
          0 reactions
          Last Post SEQadmin2  
          Working...