Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • zhigangwu
    Junior Member
    • Feb 2011
    • 3

    #1

    SOLiD seq process: Covert colorspace to basespace

    I have a collection of colorspace solid sequences to be translated into basespace sequences. After view the post http://seqanswers.com/forums/showthread.php?t=1425 , people are recommending that the official accessory python script "encodeFasta.py" which is shipped with the Corona Lite, is ideal to accomplish the task. However, I was unable to find the package Corona Lite both by following the link provided in the post and by searching Corona Lite on SOLiD's official website http://solidsoftwaretools.com/gf/. After viewing the post http://seqanswers.com/forums/showthr...ht=corona+lite , I realized that in 2009 Bioscope has replaced Corona Lite. By following the link in this post, I again failed to find what I want.
    Now I really want to ask help from people who have been dealing with SOLiD data everyday. What is the right place to go or right software package to download at this moment?

    Any suggestions are welcome and will be appreciated.


    Zhigang
    Last edited by zhigangwu; 12-08-2011, 11:03 AM.
  • pmiguel
    Senior Member
    • Aug 2008
    • 2328

    #2
    Hi Zhigang,
    It is a very bad idea to convert raw SOLiD reads into base space. Instead you should map them (converting your reference into color space) in color space. There are a wide assortment of mappers that will do this.
    --
    Phillip

    Comment

    • zhigangwu
      Junior Member
      • Feb 2011
      • 3

      #3
      Hi Phillip,
      Can you explain a bit to me why that's a bad idea?
      By borrowing idea from the script posted by roedel in http://seqanswers.com/forums/showthread.php?t=1425, I made myself one parser, which has been attached along with this post.

      Originally posted by pmiguel View Post
      Hi Zhigang,
      It is a very bad idea to convert raw SOLiD reads into base space. Instead you should map them (converting your reference into color space) in color space. There are a wide assortment of mappers that will do this.
      --
      Phillip
      Attached Files

      Comment

      • gringer
        David Eccles (gringer)
        • May 2011
        • 845

        #4
        Sequencer reads have a chance of read error (e.g. spot misidentification), combined with a chance of sequence error (e.g. polymerase misread in the PCR step). For sequencers that output in base space, both these errors have a similar effect on the base-space mapping. For sequencers that output in color-space, the read errors result in a somewhat unexpected base-space translation even if the underlying sequence has a perfect match to the reference. The issues relating to color-space to base-space translation were discussed in the thread you linked to, but here's my take on it (dumped from an email I recently sent to someone else):

        A color-space sequence is an encoding of adjacent dimers such that unchanging bases are encoded with '0', complementary changes are encoded with '3', the colour '1' is used for a non-complementary base change on the same side of the alphabet (AC, CA, GT, or TG), and the colour '2' is used for a non-complementary base change on a different side of the alphabet (AG, GA, CT, or TC). A table of these changes can be found here:



        This has a few nice properties (e.g. the reverse-complement of a color-space sequence is the same as the reverse of the color-space sequence, a SNP will have two transitions), but many annoying and nasty properties. The first is that a color-space sequence in itself is meaningless without a base reference (usually the starting base).

        Here's an example color-space sequence:

        Code:
        2112322311010133121320003202203201302321 [40 chars]
        That color-space sequence can describe four different base-space sequences:

        Code:
        0: AGTGATCTACAACCATACTGCTTTTAGGAGGCTTGCCTAGT [41 chars]
        1: CTGTCGAGCACCAACGCAGTAGGGGCTTCTTAGGTAAGCTG
        2: GACAGCTCGTGGTTGCGTCATCCCCGAAGAATCCATTCGAC
        3: TCACTAGATGTTGGTATGACGAAAATCCTCCGAACGGATCA
        Note that these sequences are one character longer than their color-space equivalent, so by adding a starting base the sequence length does not change from the base-space representation.

        Code:
        A2112322311010133121320003202203201302321 [41 chars, decoded sequence 0]
        Here's another annoying property. It was pointed out before that the reverse complement of a color-space sequence is the reverse of the sequence. This is not entirely true if you include the starting base, because that base has now shifted to the end, and is its complementary partner:
        Code:
        rc(A2112322311010133121320003202203201302321)
        =1232031023022023000231213310101132232112<rc(A)> [easy]
        =1232031023022023000231213310101132232112T [easy]
        =A1232031023022023000231213310101132232112
        The last step is computationally hard, because it requires stepping through the sequence to work in reverse to find the first base.

        And for the last trick, errors are fairly common in color-space sequence reads:
        Code:
        A2112322311010133121320003202203201302321 [original]
        A2112322311010133121310003202203201302321 [error at position 21, before the 000]
        The base-space representation of these sequences:
        Code:
        AGTGATCTACAACCATACTGCTTTTAGGAGGCTTGCCTAGT [original]
        AGTGATCTACAACCATACTGCAAAATCCTCCGAACGGATCA [after a single error]
        This error has caused the base-space representation to switch from decoded sequence 0 above to decoded sequence 3 at position 22. A match of the base-space representation of this sequence would have 20 nucleotide differences, while there is only a single difference in color-space. The great differences between base-space representations are why color-space sequences should be assembled and/or mapped in color-space.

        Comment

        • zhigangwu
          Junior Member
          • Feb 2011
          • 3

          #5
          Great Gringer, a very comprehensive explanation.


          Originally posted by gringer View Post
          Sequencer reads have a chance of read error (e.g. spot misidentification), combined with a chance of sequence error (e.g. polymerase misread in the PCR step). For sequencers that output in base space, both these errors have a similar effect on the base-space mapping. For sequencers that output in color-space, the read errors result in a somewhat unexpected base-space translation even if the underlying sequence has a perfect match to the reference. The issues relating to color-space to base-space translation were discussed in the thread you linked to, but here's my take on it (dumped from an email I recently sent to someone else):

          A color-space sequence is an encoding of adjacent dimers such that unchanging bases are encoded with '0', complementary changes are encoded with '3', the colour '1' is used for a non-complementary base change on the same side of the alphabet (AC, CA, GT, or TG), and the colour '2' is used for a non-complementary base change on a different side of the alphabet (AG, GA, CT, or TC). A table of these changes can be found here:



          This has a few nice properties (e.g. the reverse-complement of a color-space sequence is the same as the reverse of the color-space sequence, a SNP will have two transitions), but many annoying and nasty properties. The first is that a color-space sequence in itself is meaningless without a base reference (usually the starting base).

          Here's an example color-space sequence:

          Code:
          2112322311010133121320003202203201302321 [40 chars]
          That color-space sequence can describe four different base-space sequences:

          Code:
          0: AGTGATCTACAACCATACTGCTTTTAGGAGGCTTGCCTAGT [41 chars]
          1: CTGTCGAGCACCAACGCAGTAGGGGCTTCTTAGGTAAGCTG
          2: GACAGCTCGTGGTTGCGTCATCCCCGAAGAATCCATTCGAC
          3: TCACTAGATGTTGGTATGACGAAAATCCTCCGAACGGATCA
          Note that these sequences are one character longer than their color-space equivalent, so by adding a starting base the sequence length does not change from the base-space representation.

          Code:
          A2112322311010133121320003202203201302321 [41 chars, decoded sequence 0]
          Here's another annoying property. It was pointed out before that the reverse complement of a color-space sequence is the reverse of the sequence. This is not entirely true if you include the starting base, because that base has now shifted to the end, and is its complementary partner:
          Code:
          rc(A2112322311010133121320003202203201302321)
          =1232031023022023000231213310101132232112<rc(A)> [easy]
          =1232031023022023000231213310101132232112T [easy]
          =A1232031023022023000231213310101132232112
          The last step is computationally hard, because it requires stepping through the sequence to work in reverse to find the first base.

          And for the last trick, errors are fairly common in color-space sequence reads:
          Code:
          A2112322311010133121320003202203201302321 [original]
          A2112322311010133121310003202203201302321 [error at position 21, before the 000]
          The base-space representation of these sequences:
          Code:
          AGTGATCTACAACCATACTGCTTTTAGGAGGCTTGCCTAGT [original]
          AGTGATCTACAACCATACTGCAAAATCCTCCGAACGGATCA [after a single error]
          This error has caused the base-space representation to switch from decoded sequence 0 above to decoded sequence 3 at position 22. A match of the base-space representation of this sequence would have 20 nucleotide differences, while there is only a single difference in color-space. The great differences between base-space representations are why color-space sequences should be assembled and/or mapped in color-space.

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
            by SEQadmin2



            CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

            Despite this, “CRISPR helped turn genome editing from a specialized technique into
            ...
            07-31-2026, 11:01 AM
          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 08-03-2026, 10:13 AM
          0 responses
          21 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-31-2026, 02:55 AM
          0 responses
          34 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-24-2026, 12:17 PM
          0 responses
          25 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-23-2026, 11:41 AM
          0 responses
          21 views
          0 reactions
          Last Post SEQadmin2  
          Working...