Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • CS Student
    Member
    • Apr 2011
    • 20

    #bases & # reads

    Hi,

    I am new to bioinformatics and appreciate your help answering this question.

    I have a reads file [a sample is attached] and want to count the number of #bases and number of reads in this file, how do I do this? Is there a relation between the #bases and # reads in a reads file? i,e if the #bases information is available for a particular reads file, can I immediately calculate the number of reads?


    Thanks.
    Attached Files
  • chadn737
    Senior Member
    • Jan 2009
    • 392

    #2
    Assuming that all the reads are of a uniform length and have not been modified in some way (trimmed), then each read will be the same number of bases.

    In your sample fastq file:
    HTML Code:
    @SRR019388.1.1 SLXA-EAS1_126_FC20H6L_0_7_1_490_23.1 length=35
    GTCAAATATAGTGAGTACAGGAAAATAGGTGGAGA
    +SRR019388.1.1 SLXA-EAS1_126_FC20H6L_0_7_1_490_23.1 length=35
    <<<<<<<<<<<<;<<<<<<<<<<<<<<9<<;;7<;
    So your reads are 35bps long. If you know the number of reads just multiple by 35 and that equals the number of bases.

    Comment

    • westerman
      Rick Westerman
      • Jun 2008
      • 1104

      #3
      Originally posted by CS Student View Post
      Hi,

      I am new to bioinformatics and appreciate your help answering this question.

      I have a reads file [a sample is attached] and want to count the number of #bases and number of reads in this file, how do I do this? Is there a relation between the #bases and # reads in a reads file? i,e if the #bases information is available for a particular reads file, can I immediately calculate the number of reads?


      Thanks.
      There are several programs (e.g., get_fasta_stats -- search the forum for them) that will calculate read/base stats. You could also 'wc -l' the fastQ file and divide by 4 for the number of reads. Bases are bit more difficult to find via simple unix tools. Basically I suggest you do more reading and searching in the forum. Always a good way to find out information.

      There is no relation between #bases and #reads.

      Comment

      • westerman
        Rick Westerman
        • Jun 2008
        • 1104

        #4
        Originally posted by chadn737 View Post
        Assuming that all the reads are of a uniform length and have not been modified in some way (trimmed), then each read will be the same number of bases.
        And that is a big assumption. Sure, you could look at the start of the file and at the end of the file and see reads being 35 bases in length ... but are all? I wouldn't want to guarantee this on an unknown file.

        Actually from the sample file, 'CS student' should be able to figure out how many reads and the length of the reads (since this is given) via simple unix tools --- which any CS student should know. I'd use 'grep', 'cut', 'sort', and 'uniq'.

        Comment

        • GenoMax
          Senior Member
          • Feb 2008
          • 7142

          #5
          Originally posted by westerman View Post

          Actually from the sample file, 'CS student' should be able to figure out how many reads and the length of the reads (since this is given) via simple unix tools --- which any CS student should know. I'd use 'grep', 'cut', 'sort', and 'uniq'.
          Perhaps "CS Student" needs help understanding the "fastq" file format to follow your suggestion. May be a true beginner (can't tell from looking at "CS Student's" posting history).

          Comment

          • CS Student
            Member
            • Apr 2011
            • 20

            #6
            Thank you very much for your explainations. This is all what I wanted to know about # reads and #bases.

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by SEQadmin2


              I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

              Here are nine questions we think about, in roughly the order they matter, before...
              06-18-2026, 07:11 AM
            • SEQadmin2
              From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
              by SEQadmin2


              Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


              The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
              ...
              06-02-2026, 10:05 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Today, 05:37 AM
            0 responses
            5 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 06-26-2026, 11:10 AM
            0 responses
            16 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 06-17-2026, 06:09 AM
            0 responses
            49 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 06-09-2026, 11:58 AM
            0 responses
            109 views
            0 reactions
            Last Post SEQadmin2  
            Working...