Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • adarshjose
    Junior Member
    • Jul 2010
    • 6

    #1

    Paired End Mapping using Bowtie

    I am trying to map Illumina GA II E paired end reads to a reference genome.
    More than 80 % of the reads map when using single end mapping, but virtually none of the reads map when I am using paired end mapping.
    Can some one please have a look at the commands I am using and a typical example of a read I have pasted below ? Any suggestions are welcome.

    Thanks in advance

    Adarsh Jose
    BCB, Iowa State University

    I am using the following commands:

    # paired end
    bowtie Ref/ZmB73_RefGenome -1 sample_s4_1.fastq -2 sample_s4_2.fastq s4PairedMapping.map -n 2 -e 250 -l 30 -I 400 -X 460 -m 10 --time --un Unmappedpaireds4 --max Multipaireds4 -S -p 4 --verbose

    # single end
    bowtie Ref/ZmB73_RefGenome sample_s4_1.fastq s4SingleMapping_1.map -e 250 -l 30 -m 10 --time --un Unmappedsingles4_1 --max Multisingles4_1 -p 4
    bowtie Ref/ZmB73_RefGenome sample_s4_2.fastq s4SingleMapping_2.map -e 250 -l 30 -m 10 --time --un Unmappedsingles4_2 --max Multisingles4_2 -p 4

    # An example mapping of a read pair

    # Single end Pair1
    ILLUMINA-4750D6_00031:4:1:10005:2856#0/1 + chromosome:AGPv2:2:1:237068873:1 32492480 CGGCGATATAAAATAAACAACTCAGAAGCAAATCGACCCCAGAAGCCCGTCTTAC ffafff]_dfac\\\cccfcccfcf]d^]b`b[`R`dbb`bcccad`J]`b^R]^ 0 2:A>G

    # Single end Pair2
    ILLUMINA-4750D6_00031:4:1:10005:2856#0/2 - chromosome:AGPv2:2:1:237068873:1 32492560 CCATGGCATCCGCTTCCTCCTCCCAGCAGAGAAGATTAGCCAGCTTGTAGTCCTTCTTCATAGGAGG ^]dbddd[Z^^[Z\U`^Icf[fehhhaefgh_ffdffd]_ffechehfccfa`X]^]T`]a\aaaad 0

    #Paired End
    ILLUMINA-4750D6_00031:4:1:10005:2856#0 141 * 0 0 * * 0 0 CCTCCTATGAAGAAGGACTACAAGCTGGCTAATCTTCTCTGCTGGGAGGAGGAAGCGGATGCCATGG daaaa\a]`T]^]X`afccfhehceff_]dffdff_hgfeahhhef[fcI^`U\Z[^^Z[dddbd]^ XM:i:0

    ILLUMINA-4750D6_00031:4:1:10005:2856#0 77 * 0 0 * * 0 0 CGGCGATATAAAATAAACAACTCAGAAGCAAATCGACCCCAGAAGCCCGTCTTAC ffafff]_dfac\\\cccfcccfcf]d^]b`b[`R`dbb`bcccad`J]`b^R]^ XM:i:0
    Last edited by adarshjose; 02-09-2011, 07:22 PM.
  • lakshmaa
    Member
    • Jun 2010
    • 11

    #2
    I am having the same problem. Did anyone solve it ?

    Thanks
    Last edited by lakshmaa; 03-31-2011, 08:57 AM.

    Comment

    • adarshjose
      Junior Member
      • Jul 2010
      • 6

      #3
      Solution

      It is a parsing problem. The reads in both the files have to be in the same order. That is, if the 5th read in pair_1.fastq is A, then the corresponding 5th read in pair_2.fastq must also be A.

      To illustrate:

      This will work:

      pair_1.fastq

      1. >readA /1
      2. >readB /1
      3. >readC /1
      4. >readD /1

      pair_2.fastq

      1. >readA /2
      2. >readB /2
      3. >readC /2
      4. >readD /2

      but here only the 1st read pairs- readA will get mapped.


      pair_1.fastq

      1. >readA /1
      2. >readC /1
      3. >readD /1

      pair_2.fastq

      1. >readA /2
      2. >readB /2
      3. >readC /2
      4. >readD /2

      Comment

      • lakshmaa
        Member
        • Jun 2010
        • 11

        #4
        Thank you ! I will look into it

        Comment

        • nilmot13
          Member
          • Jan 2011
          • 19

          #5
          Hi,

          I'm new to using Bowtie for paired-end mapping and too have encountered the same issue.

          Did you manage to solve the parsing problem? or is there a way to program bowtie to come around the problem?

          Many thanks

          Comment

          • adarshjose
            Junior Member
            • Jul 2010
            • 6

            #6
            Its is a parsing problem

            I don't think Bowtie takes care of this. Both the files must have the reads in the same order. Please have a look at my previous post.

            Comment

            • nilmot13
              Member
              • Jan 2011
              • 19

              #7
              Hmm do you have any suggestion as to how to combat this issue?

              After clipping adaptor sequencing and trimming, often read2 becomes very short and poor in quality, which will get discarded. Do you think maintaining as much reads as possible would reduce this type of error?

              Comment

              • adarshjose
                Junior Member
                • Jul 2010
                • 6

                #8
                Split the reads into those with and without pairs

                Just split the reads after filtering into those with and without pairs. Use paired end mapping for the cases where both reads are retained after filtering and unpaired mapping for the remaining reads.

                Comment

                • nilmot13
                  Member
                  • Jan 2011
                  • 19

                  #9
                  Thank you for the advise.

                  Sorry for replying very simple question. I'm really an experimental biologist, not an experience bioinformatician. Is there a FASTQ manipulation tool or command that allows you to apply the filter for pairs?

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                    by SEQadmin2


                    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                    The systematic characterization of the human proteome has
                    ...
                    07-20-2026, 11:48 AM
                  • SEQadmin2
                    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                    by SEQadmin2



                    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                    ...
                    07-09-2026, 11:10 AM
                  • SEQadmin2
                    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                    by SEQadmin2



                    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                    07-08-2026, 05:17 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, Today, 02:55 AM
                  0 responses
                  4 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-24-2026, 12:17 PM
                  0 responses
                  10 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-23-2026, 11:41 AM
                  0 responses
                  11 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-20-2026, 11:10 AM
                  0 responses
                  23 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...