Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • dariober
    Senior Member
    • May 2010
    • 311

    How does "mpileup -Q" option work?

    Hi All,

    samtools mpileup has a -Q option which "skip bases with baseQ/BAQ smaller than INT [13]". My understanding is that bases with phred quality (11th column in SAM) less than Q are not counted in the resulting pileup, right?

    However, it seems to me that -Q has no effect. Here's an example using the toy.sam file in the example dir that comes with samtools:
    Code:
    ## Convert SAM to BAM
    samtools view -b -S /.../samtools-0.1.15/examples/toy.sam > toy.bam
    samtools view toy.bam
    r001    163     ref     7       30      8M4I4M1D3M      =       37      39      TTAGATAAAGAGGATACTG     *
    r002    0       ref     9       30      1S2I6M1P1I1P1I4M2I      *       0       0       AAAAGATAAGGGATAAA       *
    r003    0       ref     9       30      5H6M    *       0       0       AGCTAA  *
    r004    0       ref     16      30      6M14N1I5M       *       0       0       ATAGCTCTCAGC    *
    r003    16      ref     29      30      6H5M    *       0       0       TAGGC   *
    r001    83      ref     37      30      9M      =       7       -39     CAGCGCCAT       *
    x1      0       ref2    1       30      20M     *       0       0       AGGTTTTATAAAACAAATAA    ????????????????????
    x2      0       ref2    2       30      21M     *       0       0       GGTTTTATAAAACAAATAATT   ?????????????????????
    x3      0       ref2    6       30      9M4I13M *       0       0       TTATAAAACAAATAATTAAGTCTACA      ??????????????????????????
    x4      0       ref2    10      30      25M     *       0       0       CAAATAATTAAGTCTACAGAGCAAC       ?????????????????????????
    x5      0       ref2    12      30      24M     *       0       0       AATAATTAAGTCTACAGAGCAACT        ????????????????????????
    x6      0       ref2    14      30      23M     *       0       0       TAATTAAGTCTACAGAGCAACTA ???????????????????????
    
    
    ## Produce pileup:
    samtools mpileup toy.bam > toy.mpileup
    
    ## Produce pileup with ridiculously high -Q:
    samtools mpileup -Q 100 toy.bam > toyQ.mpileup
    
    ## -Q has no effect!
    wc toy.mpileup toyQ.mpileup
    75  450 1473 toy.mpileup
    75  450 1473 toyQ.mpileup
    150  900 2946 total
    I'm using samtools 0.1.15. Am I missing something obvious here?

    All the best

    Dario
  • ramensky
    Junior Member
    • May 2010
    • 1

    #2
    Hi, I had the same confusion, too. My experience is that -Q affects the output only in the BCF output mode (invoked with -u or -g), but not in the pileup mode, as in your example. In the meantime, -q (min read mapping quality) applies to both output modes.

    Hope this helps.
    Last edited by ramensky; 02-02-2012, 04:43 PM.

    Comment

    Latest Articles

    Collapse

    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      07-01-2026, 11:43 AM
    • SEQadmin2
      Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by SEQadmin2


      I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

      Here are nine questions we think about, in roughly the order they matter, before...
      06-18-2026, 07:11 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 07-02-2026, 11:08 AM
    0 responses
    16 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-30-2026, 05:37 AM
    0 responses
    17 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-26-2026, 11:10 AM
    0 responses
    20 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-17-2026, 06:09 AM
    0 responses
    54 views
    0 reactions
    Last Post SEQadmin2  
    Working...