Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • sehrrot
    Member
    • Jul 2010
    • 58

    Picard Error: IllegalArgumentException: Invalid fastq character:

    hi all

    I'm having trouble in using Picard to covert sam to bam. it seems to be halted by weird characters (I cannot type it here)

    Ignoring SAM validation error due to lenient parsing:
    Error parsing text SAM file. length(QUAL) != length(SEQ); Line 28
    Line: DFCDZDN1:130:B01D5ACXX:4:1101:1099:2046 99 chr3 134076497 60 100M = 134076563 166 AGGGCAGAGGAGGGGAGAGAATGGCTCAGAGTCCTGAAGCACCACCTCCTTCAGATCAGTATCTCCACCATGTCTGACAAGTCCTGGANTCTGGATGTAG $$$''''%)))))++*+((**+*+++++**+'))++**++**+**+(*)++++))))()'''''''%&%%$$"$&%$$$$%"$%$%% (weird character here)
    [Thu Feb 23 15:13:19 EST 2012] net.sf.picard.sam.SortSam done. Elapsed time: 0.00 minutes.
    Runtime.totalMemory()=123666432
    Exception in thread "main" java.lang.IllegalArgumentException: Invalid fastq character: (weird character here)
    at net.sf.samtools.SAMUtils.fastqToPhred(SAMUtils.java:408)
    at net.sf.samtools.SAMUtils.fastqToPhred(SAMUtils.java:387)
    at net.sf.samtools.SAMRecord.setBaseQualityString(SAMRecord.java:254)
    at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:422)
    at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:278)
    at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:250)
    at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:641)
    at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:619)
    at net.sf.picard.sam.SortSam.doWork(SortSam.java:67)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:119)
    at net.sf.picard.sam.SortSam.main(SortSam.java:79)
  • swbarnes2
    Senior Member
    • May 2008
    • 910

    #2
    Either the fastq was made wrongly, or the .sam was made wrongly. Those are not normal quality characters.
    Last edited by swbarnes2; 02-22-2012, 10:18 PM.

    Comment

    • maubp
      Peter (Biopython etc)
      • Jul 2009
      • 1544

      #3
      What is the weird characters? Try using hexdump.

      Comment

      • sehrrot
        Member
        • Jul 2010
        • 58

        #4
        Hi all

        now it's working fine after I removed "-I" from bwa alignment process ("bwa aln -t 4 -f input.sai -I hg19 input.fastq")

        Comment

        • maubp
          Peter (Biopython etc)
          • Jul 2009
          • 1544

          #5
          So you probably have Sanger style FASTQ, which is what the latest Illumina pipeline produces - but you told bwa it was the legacy Illumina specific FASTQ encoding.

          See:


          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by SEQadmin2


            I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.


            Here are nine questions we think about, in roughly the order they matter, before...
            Yesterday, 07:11 AM
          • SEQadmin2
            From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
            by SEQadmin2


            Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


            The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
            ...
            06-02-2026, 10:05 AM
          • SEQadmin2
            Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
            by SEQadmin2


            With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


            Introduction

            Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
            05-22-2026, 06:42 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 06-17-2026, 06:09 AM
          0 responses
          20 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-09-2026, 11:58 AM
          0 responses
          38 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-05-2026, 10:09 AM
          0 responses
          44 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-04-2026, 08:59 AM
          0 responses
          49 views
          0 reactions
          Last Post SEQadmin2  
          Working...