Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Bio.X2Y
    Member
    • Apr 2010
    • 46

    #1

    BWA Soft Clipping

    Hi,

    When I run BWA without specifying a "q" value (which defaults to 0 as I understand it from the manual), I would not expect any trimming to occur.

    However, the resulting alignments have lots of soft-clippings at the edges. Aren't these trimmings?

    Thanks!
  • dawe
    Senior Member
    • Apr 2009
    • 258

    #2
    Which value have you specified? Why would you expect trimming not to occur?
    Also, if you specify a q value, you should see information about trimming while bwa is running.

    d

    Comment

    • Bio.X2Y
      Member
      • Apr 2010
      • 46

      #3
      Hi, I didn't specify a "q" value, and the BWA manual implies that this means a default value of "0" is used.

      The official description of "q" is a bit cryptic for a non-mathematician, but I thought that the default value of "0" would lead to no trimming? If this isn't the case, how can I prevent trimming?

      Thanks.

      Comment

      • dawe
        Senior Member
        • Apr 2009
        • 258

        #4
        Originally posted by Bio.X2Y View Post
        Hi, I didn't specify a "q" value, and the BWA manual implies that this means a default value of "0" is used.

        The official description of "q" is a bit cryptic for a non-mathematician, but I thought that the default value of "0" would lead to no trimming? If this isn't the case, how can I prevent trimming?

        Thanks.
        Whoops! Sorry for misreading your post.
        Can you post a soft-clipped entry? Could it be some effect of SW alignment instead?

        d

        Comment

        • Bio.X2Y
          Member
          • Apr 2010
          • 46

          #5
          Hi,
          Below is an example (both ends shown).

          I'm not sure what you mean by this being an artefact of SW alignment? I would have thought that trimming would either (a) be allowed or (b) not allowed.

          Thanks for your help!

          SRR018256.13099683 83 RN28S1|NR_003287.2 4925 29 51M 4550 -426 CCCCCCGTCACGCACCGCACGTTCGTGGGGAACCTGGCGCTAAACCATTCG #%#&&$($($&'%$,#&+%+'+&)((0,**.0++,+1)65.7C+II<@II. XT:A:U NM:i:2 SM:i:29 AM:i:29X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:0T1G48
          SRR018256.13099683 163 RN28S1|NR_003287.2 4550 29 45M6S 4925 426 GTTAGTTTTACCCTACTGATGATGTGTTGTTGCCATAGTAATCCTNTNTAG I+I;-77I=,10>9/55I)*;%1+%*++%0+))&$%#'$&"'%))!#!$"% XT:A:M NM:i:1 SM:i:29 AM:i:29XM:i:1 XO:i:0 XG:i:0 MD:Z:36G8

          Comment

          • dawe
            Senior Member
            • Apr 2009
            • 258

            #6
            Originally posted by Bio.X2Y View Post
            Hi,
            Below is an example (both ends shown).

            I'm not sure what you mean by this being an artefact of SW alignment? I would have thought that trimming would either (a) be allowed or (b) not allowed.
            I don't mean that's an artifact. bwa extends your match by smith-waterman alignment. I guess the terminal part of a read may be soft-clipped if this implies a higher score.
            Trimming is quite different, as it is performed at alignment time evaluating the read qualities.

            d

            Comment

            • pparg
              Member
              • Aug 2008
              • 19

              #7
              How do I know that –q INT option I set has taken effect? I have 51-nt pair-end reads too. It seems to me that nothing has been trimmed, as the read lengths indicated by CIGAR string column are all 51. is there any other column to check on whether quality trimming has occured?
              A related question is the same as Bio.X2Y’s: the resulting alignments have lots of soft-clippings at the edges. Aren't these trimmings? Based on the description of –q INT option in BWA documentation, I would expect soft-clippings (due to trimming) only occur at the right end of sequences, instead of both ends. But I see soft-clippings occur at both ends frequently.
              Thanks a lot for any inputs! It would also be great if anyone could clarify BWA quality trimming issue a little bit as quite a few people here have similar questions.

              Comment

              • lh3
                Senior Member
                • Feb 2008
                • 686

                #8
                bwa may do smith-waterman alignment, which produces soft clipping.

                Comment

                • pparg
                  Member
                  • Aug 2008
                  • 19

                  #9
                  What about the quality trimming? Does it actually happen, or it produces soft-clippings too? Thanks!

                  Comment

                  • CNVboy
                    Member
                    • Jun 2011
                    • 27

                    #10
                    Originally posted by pparg View Post
                    How do I know that –q INT option I set has taken effect? I have 51-nt pair-end reads too. It seems to me that nothing has been trimmed, as the read lengths indicated by CIGAR string column are all 51. is there any other column to check on whether quality trimming has occured?
                    A related question is the same as Bio.X2Y’s: the resulting alignments have lots of soft-clippings at the edges. Aren't these trimmings? Based on the description of –q INT option in BWA documentation, I would expect soft-clippings (due to trimming) only occur at the right end of sequences, instead of both ends. But I see soft-clippings occur at both ends frequently.
                    Thanks a lot for any inputs! It would also be great if anyone could clarify BWA quality trimming issue a little bit as quite a few people here have similar questions.

                    This may be a late answer.
                    To my understanding, you guys are confused about "-q opiton(quality trimming)" and " soft-clipped".

                    -q option is to trim those crappy ends of reads with very low Phred score, ie. bad quality, which can be due to sequencing errors. Such trimming serves as pre-processing before running BWA.

                    While "soft-clipped" refers to the reads whose certain part may find nowhere to align to, say, for those split-read covering breakpoints. BWA still preserves those "unmapped" part for downstream analysis because it could be caused by say translocation, deletion blablabla.

                    So basically you are talking about two different things.

                    Comment

                    • xiangwulu
                      Member
                      • Apr 2014
                      • 18

                      #11
                      Originally posted by CNVboy View Post
                      This may be a late answer.
                      To my understanding, you guys are confused about "-q opiton(quality trimming)" and " soft-clipped".

                      -q option is to trim those crappy ends of reads with very low Phred score, ie. bad quality, which can be due to sequencing errors. Such trimming serves as pre-processing before running BWA.

                      While "soft-clipped" refers to the reads whose certain part may find nowhere to align to, say, for those split-read covering breakpoints. BWA still preserves those "unmapped" part for downstream analysis because it could be caused by say translocation, deletion blablabla.

                      So basically you are talking about two different things.
                      Hi, I think that we know that the trimming and soft-clipping are made for different purposes, but in the SAM file, the cigar string shows the clipping information: e.g. 4S26M but not the reason why its clipped.

                      The problem here is: why does bwa clipped/trimmed reads when -q option is not specified? is soft-clipping its part of bwa's nature?

                      I have also noticed that lots alignment tools do the soft-clipping, even it is not an option stated in the manual or parameters. On one side, soft-clipping would generate more alignments, or maybe 'higher' alignment rate, but what about if we want the alignment results with exactly 1 mismatch?

                      I think the soft-clipping is a bit collision to the mismatch option. For "4S26M", would the '4' also count as mismatch allowed = 4?

                      Comment

                      • Brian Bushnell
                        Super Moderator
                        • Jan 2014
                        • 2709

                        #12
                        I don't know if this is that case for that specific read, since you didn't post the whole line, but the sam specification requires clipping if a read goes of the end of a reference sequence.

                        Comment

                        Latest Articles

                        Collapse

                        • SEQadmin2
                          Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                          by SEQadmin2
                          CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                          Despite this, “CRISPR helped turn genome editing from a specialized technique into a standard research
                          ...
                          Today, 11:01 AM
                        • SEQadmin2
                          Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                          by SEQadmin2


                          Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                          The systematic characterization of the human proteome has
                          ...
                          07-20-2026, 11:48 AM
                        • SEQadmin2
                          Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                          by SEQadmin2



                          Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                          ...
                          07-09-2026, 11:10 AM

                        ad_right_rmr

                        Collapse

                        News

                        Collapse

                        Topics Statistics Last Post
                        Started by SEQadmin2, Today, 02:55 AM
                        0 responses
                        6 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 07-24-2026, 12:17 PM
                        0 responses
                        11 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 07-23-2026, 11:41 AM
                        0 responses
                        12 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 07-20-2026, 11:10 AM
                        0 responses
                        24 views
                        0 reactions
                        Last Post SEQadmin2  
                        Working...