Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • *#1*
    Junior Member
    • Jul 2010
    • 8

    How to trim multiple alignment?

    I have a specific problem. We want to discover isoforms of a gene based on long reads. We have a population of overlapping sequences all under 1000bp. I aligned them with Clustal, and now would like to trim the edges so that only common area for all sequences is remained.
    So, I need to convert alignment like this:

    >>>>>>>>>>atgcatgcatgcqtgatgctgatgctagtgctagtgctagtcgtagctga
    gcatgcatgcatgcatgcatgcqtgatgctgatgctagtgctagtgcta
    >>>>>>catgcatgcatgcatgcqtgatgctgatgctagtg
    >>>>>>>>>>>>gcatgcatgcatgcqtgatgctgatgctagtgctagt



    to
    atgcatgcatgcqtgatgctgatgctagtg
    atgcatgcatgcqtgatgctgatgctagtg
    atgcatgcatgcqtgatgctgatgctagtg
    atgcatgcatgcqtgatgctgatgctagtg


    Is there a way to do that in Linux? Right now the alignment is in CLC Bio, but I can export it to SAM/BAM or possibly to text as well.

    My understanding is that if I trim produce a text file with the alignment, I can then run uniq -c command in Linux and get both unique sequences in my list, and counts (-c) for each of them.

    Any advise on how to do that best are appreciated. I am not too handy with PERL or Python though, so shell scripts or some unix tricks would be more desirable.

    Thanks!

    Thanks for any input
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    Avoiding Perl or Python (which is how I would do this), many biologists I know used to or still use BioEdit for that kind of thing, but it is Windows only and dead software. You might try JalView http://www.jalview.org/ or UGENE http://ugene.unipro.ru/ which are both free, open source and cross platform.

    Comment

    • *#1*
      Junior Member
      • Jul 2010
      • 8

      #3
      Thank you for the reply. I can certainly do simple Perl and Python, but I am not sure how to approach the problem. If you have ready to use scripts, I'd appreciate your posting them here.
      Thanks!

      Comment

      Latest Articles

      Collapse

      • GATTACAT
        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by GATTACAT
        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
        07-01-2026, 11:43 AM
      • SEQadmin2
        Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by SEQadmin2


        I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

        Here are nine questions we think about, in roughly the order they matter, before...
        06-18-2026, 07:11 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-02-2026, 11:08 AM
      0 responses
      22 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-30-2026, 05:37 AM
      0 responses
      23 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-26-2026, 11:10 AM
      0 responses
      22 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-17-2026, 06:09 AM
      0 responses
      55 views
      0 reactions
      Last Post SEQadmin2  
      Working...