Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • efoss
    Member
    • Jul 2011
    • 98

    #1

    problem understanding NCBI SRA fastq files

    I downloaded some sra files from NCBI's short read archive and converted them to fastq format. The experiment is described as paired end reads, so I expected to get two fastq files from each sra file. Instead, I only got one fastq file from each. Then I thought that I could find which reads were read1 reads and which ones were read2 reads, but I couldn't see anything to indicate whether it's a read1 or a read2. Here are some lines from one of the files:


    @SRR254172.11 ILLUMINA-20A1B2_0004_FC6282EAAXX:6:1:1921:953 length=160
    NACAAAGGTAATTGCAAGTCCCTTCGTGCCAAAACGTCCAGCCCTTCCAACCCTGTGCAAATAAGTATCAGCTGAGTCTGAATCTGCATTCATTCTGGAATGACTCAGGAAGAAAGGCTAACAAGATATAAGAACTTCAAGGAAGGCCACAAGAGAATTC
    +SRR254172.11 ILLUMINA-20A1B2_0004_FC6282EAAXX:6:1:1921:953 length=160
    #)0+)**2,,@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@:3:::@@@22:<<:8@@:@@@@@@@IIHIIIIIIII?HHIIFIGIIIIIIEGIGHIIIIFAIBDIHHGEHDBEFIIB<IIHHI3EFEDFC@HH@F@2;8<>@0??

    You get one line starting with @, then a line with the sequence, then a line essentially identical to the @ line except starting with + rather than @, and then a line with base quality scores.

    Does anyone understand this format and how I can get fastq files for both read1 and read2?

    Thank you.

    Eric
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    The basics of FASTQ are described here http://nar.oxfordjournals.org/conten...r.gkp1137.full and http://en.wikipedia.org/wiki/FASTQ_format

    How did you do the conversion? I recall there are extra switches needed at the command line for paired end data...
    Last edited by maubp; 03-30-2012, 12:23 AM.

    Comment

    • efoss
      Member
      • Jul 2011
      • 98

      #3
      Originally posted by maubp View Post
      How did you do the conversion? I recall there are extra switches needed at the command line for paired end data...
      Hi Maubp,

      I'll bet that that's where I'm making a mistake. I did the conversion in two ways, neither of which gave me the paired end reads I wanted:

      fastq-dump *.sra

      fastq-dump.2 *.sra

      Eric

      Comment

      • jrm5100
        Junior Member
        • Mar 2012
        • 1

        #4
        You need to use the --split-3 option.

        fastq-dump --split-3 *.sra

        Comment

        • efoss
          Member
          • Jul 2011
          • 98

          #5
          Originally posted by jrm5100 View Post
          You need to use the --split-3 option.

          fastq-dump --split-3 *.sra
          Thanks so very much!!

          Eric

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            How Immunogenomics Decodes Immunity’s Genetic Blueprint
            by SEQadmin2




            The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

            This convergence of genetics, immunology, and computation...
            Yesterday, 05:41 AM
          • SEQadmin2
            Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
            by SEQadmin2



            CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

            Despite this, “CRISPR helped turn genome editing from a specialized technique into
            ...
            07-31-2026, 11:01 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 08-24-2026, 10:32 AM
          0 responses
          42 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 08-20-2026, 11:17 AM
          0 responses
          48 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 08-18-2026, 10:05 AM
          0 responses
          55 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 08-13-2026, 12:22 PM
          0 responses
          50 views
          0 reactions
          Last Post SEQadmin2  
          Working...