Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • LizBent
    Member
    • Jan 2012
    • 31

    Process to remove primers, adapters, etc. from Illumina data

    Hi all,

    I have some Illumina paired-end (100 bp) read data and have seen this very useful page: http://intron.ccam.uchc.edu/groups/t...Sequences.html

    It has some primer adapter sequences and primer sequences in it. My question is, do I have to remove any additional sequences than the ones on this page and the primers I used to amplify my cDNA, such as the index primers? Is the sequence for index primers the same as the PE sequencing or PCR primers given in the link above, with just the index tag added?

    Should I worry about reverse complementing all of these and removing those sequences as well?

    Liz
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    It is always good to start with QC on your data. You will find there are several tools to do this.

    FastQC (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/) and Fastx toolkit (http://hannonlab.cshl.edu/fastx_toolkit/) are good ones to start with. There are utilities that will help you remove the adapters if they are present in your sequences. One more alternative is cutadapt (http://code.google.com/p/cutadapt/).
    Last edited by GenoMax; 01-27-2012, 05:45 AM.

    Comment

    • LizBent
      Member
      • Jan 2012
      • 31

      #3
      Hi, I'm aware of the FastXtoolkit and other tools mentioned. My question is not how to remove adapters and primers, but more whether I need to reverse complement adapters and primers and remove the reverse complemented sequences as well.

      Comment

      • fkrueger
        Senior Member
        • Sep 2009
        • 627

        #4
        We find that using the first 13bp of the Illumina adapter ('AGATCGGAAGAGC') efficiently removes adapter contamination for both paired-end files (the adapters on both sides share this sequence before they fork, and any of the Illumina multiplex barcodes should be further downstream of that).

        A typical command for Cutadapt could be

        ./cutadapt -f fastq -O $stringency -q 20 -a AGATCGGAAGAGC input_file.fastq

        $stringency would define the overlap with the adapter required for it to remove sequence from the end, the default is 3 I believe. This command would remove poor quality sequence as well as adapters from your FastQ file.

        You should only be careful with the option of removing sequences if they become too short, because this can throw off the sequence-by-sequence order of paired-end files which is required by many aligners.

        I hope this helps

        Comment

        • LizBent
          Member
          • Jan 2012
          • 31

          #5
          Thanks! I'm trying to figure out how to QC data before trying to use it in Velvet and Trinity.

          Comment

          • LizBent
            Member
            • Jan 2012
            • 31

            #6
            I've tried the 13-mer adapter end sequence with the FastXtoolkit (Clip), and it didn't remove any reads. However, when I use the full primer sequences, reads are clipped and removed. I'm going to try clipping the 13-mer sequence with CutAdapt, but I thought I would mention it in case anyone can tell me the difference between how these programs work.

            Comment

            • rahularjun86
              Member
              • Jan 2011
              • 58

              #7
              Hi,
              One could also try simple grep to have a rough idea regarding the adapter sequences.
              HTML Code:
              grep -c "^GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG" *.fastq
              grep -c "GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG$" *.fastq
              grep -c "GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG" *.fastq
              You can also try 13-mer sequence.
              Thanks,
              Rahul
              Rahul Sharma,
              Ph.D
              Frankfurt am Main, Germany

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM
              • SEQadmin2
                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                by SEQadmin2



                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                07-08-2026, 05:17 AM
              • GATTACAT
                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                by GATTACAT
                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                07-01-2026, 11:43 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 07-13-2026, 10:26 AM
              0 responses
              20 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-09-2026, 10:04 AM
              0 responses
              31 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-08-2026, 10:08 AM
              0 responses
              20 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-07-2026, 11:05 AM
              0 responses
              34 views
              0 reactions
              Last Post SEQadmin2  
              Working...