Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • bioinfosm
    Senior Member
    • Jan 2008
    • 483

    SOAP denovo assembly results

    Hi,

    I was able to assemble more than 100 million reads to contigs using SOAP. That was cool, as all other tools ran into memory issues..

    However, I wish to understand some of the properties of contigs, like
    - how many reads were actually used in the assembly
    - what kind of depth of coverage do the contigs have from overlapping reads
    - other properties to determine how confident I could be of the contigs

    any pointers... and any help with extracting info from the soap assembly results (except the contig sequences I already have)
    --
    bioinfosm
  • henry
    Member
    • Sep 2009
    • 36

    #2
    Originally posted by bioinfosm View Post
    Hi,

    I was able to assemble more than 100 million reads to contigs using SOAP. That was cool, as all other tools ran into memory issues..

    However, I wish to understand some of the properties of contigs, like
    - how many reads were actually used in the assembly
    - what kind of depth of coverage do the contigs have from overlapping reads
    - other properties to determine how confident I could be of the contigs

    any pointers... and any help with extracting info from the soap assembly results (except the contig sequences I already have)
    This is a good question. I also wanna know. could anyone kindly help us?
    Btw, how much time did it take to denovo assemble more than 100 million reads into contigs?

    Best

    Jing

    Comment

    • lcollado
      Member
      • Jun 2009
      • 65

      #3
      How much RAM did you need with SOAP? I'm curious ^^
      L. Collado Torres, Ph.D. student in Biostatistics.

      Comment

      • bioinfosm
        Senior Member
        • Jan 2008
        • 483

        #4
        Less than 100Gb RAM, I did not track it (as long as it was not crashing, I was happy)
        Time, it took less than a day to get done with its various steps. A lot of contigs are length 24 and definitely not useful.
        >1 length 24 cvg_0_tip_0
        AAAAAAAAAAAAAAAAAAAAAAAA
        >3 length 24 cvg_0_tip_0
        AAAAAAAAAAAAAAAAAAAAAAAC
        ...
        >347 length 65 cvg_10_tip_0
        TTCAGTAATAACGGCAGACTAATCACCTCAGAAAACACAAAGCACAAGCTTGTGCTTGTCACTTC


        Looking for some documentation to understand this better...
        --
        bioinfosm

        Comment

        • node
          Member
          • Sep 2009
          • 10

          #5
          Hi

          A better way to ask for help about SOAPdenovo , is join to SOAP's mailing list !

          And here is the SOAP site: http://soap.genomics.org.cn . You can submit your email on the home page .

          PS: SOAP use Google group as it's mailing list .
          Another developer ! Focus on Bioinformatics,Internet,Math :0 with URL yangzt.com and vbio.info

          Comment

          • rubi
            Junior Member
            • Apr 2011
            • 6

            #6
            Hi,

            Can anyone refer me to good documentation on quality assessment of soap denovo assembly (e.g., n50 values, how to compute coverage, and what the output files mean, etc...)

            Thanks

            Comment

            • y.divyatej@gmail.com
              Junior Member
              • Feb 2011
              • 4

              #7
              Denovo assembly pipeline

              I'm curious if there is a pipeline available for Soap De novo assembly. Is there a requirement for the number of genomes required for Denovo assembly?

              Comment

              • narain
                Banned
                • Aug 2011
                • 73

                #8
                Dear Members

                I am doing de-novo assembly of human genome from fastq data files. I get contigs as well as scaffolds from tools that I use. I know that scaffolds are a combination of contigs with estimated gaps in between them. Does this mean that downstream analysis when comparing it to another genome such as the reference should be done with contigs more reliably than with scaffolds ?

                Aby

                Comment

                • darren.cullerne
                  Junior Member
                  • May 2011
                  • 1

                  #9
                  bioinfosm:
                  However, I wish to understand some of the properties of contigs, like
                  - how many reads were actually used in the assembly
                  - what kind of depth of coverage do the contigs have from overlapping reads
                  - other properties to determine how confident I could be of the contigs
                  The way our "lab" (aka office) has looked at the number of reads used in an assembly is to take the raw reads and back align them against the newly created denovo contigs. It should give a pretty good indication. We use Kanga for our back alignments. Damned quick and efficient:

                  Comment

                  • sagarutturkar
                    Member
                    • Sep 2010
                    • 61

                    #10
                    I am confused about contig numbers reported by Soap.I was trying to
                    run SoapDenovo for small microbial genomes (Size varies from 5-10MB).

                    However, the number of contigs reported in .contig files is very high
                    (always in thousands) whereas other assemblers giving me contigs less
                    than 500. But Soap-Scaffolding output was better than other
                    assemblers.

                    I am not sure, if I am looking at some intermediate contig file OR
                    contig number is always high in Soap? From my experience contig and
                    Scaffolds numbers differ by few 100s only (at least for small microbial genomes). There is no drastic change, but in Soap contigs were in 2000-3000 range while scaffolds were in 200-500 range. Please explain.

                    Comment

                    Latest Articles

                    Collapse

                    • SEQadmin2
                      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                      by SEQadmin2



                      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                      ...
                      07-09-2026, 11:10 AM
                    • SEQadmin2
                      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                      by SEQadmin2



                      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                      07-08-2026, 05:17 AM
                    • GATTACAT
                      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                      by GATTACAT
                      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                      07-01-2026, 11:43 AM

                    ad_right_rmr

                    Collapse

                    News

                    Collapse

                    Topics Statistics Last Post
                    Started by SEQadmin2, 07-13-2026, 10:26 AM
                    0 responses
                    24 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-09-2026, 10:04 AM
                    0 responses
                    34 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-08-2026, 10:08 AM
                    0 responses
                    21 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-07-2026, 11:05 AM
                    0 responses
                    34 views
                    0 reactions
                    Last Post SEQadmin2  
                    Working...