Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • bostonian
    Junior Member
    • Jun 2012
    • 4

    data format and how to analysis

    Hi,

    I am a complete newbie, so please bear with me if my question seems too silly.

    I recently downloaded a RNAseq dataset from GEO, it contains paired data files, and in the following format:

    readID Seq 0-mi**** 1-mi**** 2-mi**** chr start end strand
    HWUSI-EAS230-R:2:99:1151:1802#0/1 GAGCTCATTGGTGGCGTGGTGGCCTTGACCTTCCGG 1 0 0 chr10 70914936 70914971 -
    HWUSI-EAS230-R:2:44:642:495#0/1 TTGGCTGCCTTCTGGGGTGAACTTTCTGCTATTTCC 0 0 1 chr7 47298110 47298145 -

    ......

    I googled around but could not figure out what format it is, and how to proceed to analyze. My goal is to produce gene expression values (RPKM) from these data files.

    Thanks so much for your help.
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    It'd help if you mentioned the GEO accession number. They probably mention more about the format in the GEO entry. If nothing else, you could probably convert that to SAM/BAM format (the difficulty being whether or not the mappings are actually unique) and then calculate the RPKM. Alternatively, if they provide no further information (or the original fastq file), you could convert that to a multi-fasta file and then realign it.

    Comment

    • bostonian
      Junior Member
      • Jun 2012
      • 4

      #3
      Hi, Thanks a lot for your response. The dataset is GSE22260. I do not see any mentioning about the data formet, but maybe it is only because I do not know where to look. Could you also advise how to convert what I have to SAM/BAM format? or how to convert to multi-fasta files? I am fairly familiar with R, so I am hoping I will be able figure the later analysis after I have data in BAM format. Thanks again.

      Comment

      • westerman
        Rick Westerman
        • Jun 2008
        • 1104

        #4
        I believe that these are output from "Illumina Genome Analyzer Pipeline". I am not sure if there is a converter from this format to SAM/BAM. Multi-fastA would be trivial. Something like:

        cut -f 1,2 file.name | sed -e 's/^/>/' -e 's/\t/\n' > output.file

        or

        perl -nale 'print ">$F[0]\n$F[1]"' file.name > output.file

        Then you could map the reads against a current human genome and go from there.

        Comment

        • bostonian
          Junior Member
          • Jun 2012
          • 4

          #5
          Thank, Rick. I am trying to avoid doing alignment myself. Since each sequence comes with chromosome number and genomic coordinates in the data file, I assume they are already aligned (?). Is there any tool that I can use to convert the data into some format so that I can read them into some R packages, such as ShortRead or others (?), for further analysis?

          Comment

          • dpryan
            Devon Ryan
            • Jul 2011
            • 3478

            #6
            As Rick suggested and they state in the data processing section of each sample, the files are from the Genome Analyzer Pipeline (there are two files for each sample, since this is paired-end data). If you were willing to redo the alignment, you can download the reads from SRA and convert them to fastq with fastq-dump. Alternatively, it wouldn't be difficult to write a small program in perl/python/R/whatever to read in both read files at once and output to SAM. Just make sure that corresponding lines in each file are actually meant to go together (that is, ensure that read names match), as if they kept reads where only one end maps then you would otherwise get really screwy results. So, just put a * in the base quality field and make up an appropriate fake MAPQ value along with the correct flag and you're good to go.

            Comment

            • westerman
              Rick Westerman
              • Jun 2008
              • 1104

              #7
              @bostonian

              I do not use ShortRead however reading the manual ShortRead uses the readAligned part of bioconductor. I am not sure that readAligned will read in your file directly however the fields are similar and I suspect that with some simple data manipulation you could get them read in.


              BTW: It is this type of data manipulation that makes bioinformatics such a joy. :-)

              Comment

              • rboettcher
                Member
                • Oct 2010
                • 71

                #8
                @bostonian

                I am currently struggling with the same issue, did you find a solution for your problem?

                Comment

                Latest Articles

                Collapse

                • SEQadmin2
                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                  by SEQadmin2



                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                  ...
                  07-09-2026, 11:10 AM
                • SEQadmin2
                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                  by SEQadmin2



                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                  07-08-2026, 05:17 AM
                • GATTACAT
                  Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                  by GATTACAT
                  Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                  07-01-2026, 11:43 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, 07-13-2026, 10:26 AM
                0 responses
                24 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-09-2026, 10:04 AM
                0 responses
                33 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-08-2026, 10:08 AM
                0 responses
                21 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-07-2026, 11:05 AM
                0 responses
                34 views
                0 reactions
                Last Post SEQadmin2  
                Working...