Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • ECO
    --Site Admin--
    • Oct 2007
    • 1360

    #16
    Ok sorry for the delay all...please see attached document for my results/experience. There is a review of standard truseq, the design that I came up with with help from this thread, and an example samplesheet.

    Everything comes with my standard disclaimer of "if you don't know what you're doing you WILL mess something up" and...this is based on one successful run of testing...so this is very experimental.
    Attached Files

    Comment

    • Vinz
      Member
      • Dec 2010
      • 80

      #17
      Originally posted by pmiguel View Post
      So that would be a hemi-methylated DpnI site? With the flowcell oligo contributing the methylated adenine required for DpnI to cut?

      --
      Phillip
      Hi Philip,
      that was the idea. But ECO pointed out that it is probably uracil at some position and some uracil dependant cleavage.

      Comment

      • ECO
        --Site Admin--
        • Oct 2007
        • 1360

        #18
        I could definitely be wrong though!! It seems crazy to rely on restriction when more specificity would be achieved by uracil dependent cleavage.

        The flow cell primer having a uracil at that position is a bit of a clue too...assuming that info is correct.

        Comment

        • ThePhotosyntheticMan
          Junior Member
          • Jul 2012
          • 2

          #19
          Hi all, I'm new to NGS so approach this post with a healthy dose of skepticism.

          I'm in the process of designing PCR primers for a targeted approach to sequencing dual indexed amplicons on the MiSeq. After reading ECO's posts, this is what I've deduced about primer design:

          FORWARD PCR PRIMER:
          5’ – AATGATACGGCGACCACCGAGA{TCTACAC}nnnnnnnnACACTCTTTCCCTACACGACGCTCTTCCGATCT[Forward primer sequence]
          REVERSE PCR PRIMER:
          5’ – CAAGCAGAAGACGGCATACGAGATnnnnnnnnGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT[Reverse primer sequence]

          ...where bold = i5 and i7 indices, respectively.

          This confuses me because the sequences following the indices are different from those introduced by the transposon. According to Illumina's Customer Sequence Letter, a targeted PCR strategy that mimics samples prepped using Nextera would have primers that appear as follows:

          FORWARD PCR PRIMER:
          5' - AATGATACGGCGACCACCGAGA{TCTACAC}nnnnnnnnTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG[Forward primer sequence]
          REVERSE PCR PRIMER:
          5’ – CAAGCAGAAGACGGCATACGAGATnnnnnnnnGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG[Reverse primer sequence]

          ...which would mean Read 1, Index 1, and Read 2 sequencing primers are different, hence my confusion. Will either of these strategies work on the MiSeq? Has the above strategy worked for some folk? My thanks in advance.

          Comment

          • TonyBrooks
            Senior Member
            • Jun 2009
            • 303

            #20
            I think both should work.
            The Illumina read primer is actually a primer mix of several primers. I guess there's probably primers for both sequences in there (TruSeq and Nextera).

            However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.

            Comment

            • ThePhotosyntheticMan
              Junior Member
              • Jul 2012
              • 2

              #21
              Originally posted by TonyBrooks View Post
              I think both should work.
              The Illumina read primer is actually a primer mix of several primers. I guess there's probably primers for both sequences in there (TruSeq and Nextera).

              However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.
              Got it. Thanks!

              Comment

              • gnomers
                Junior Member
                • Dec 2009
                • 4

                #22
                Originally posted by TonyBrooks View Post
                I think both should work.
                The Illumina read primer is actually a primer mix of several primers. I guess there's probably primers for both sequences in there (TruSeq and Nextera).

                However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.
                We've been using custom read primers on an amplicon library successfully on the HiSeq. However, we just tried the exact same strategy on the MiSeq and it failed utterly (nothing but PhiX in the first (index) read.)

                Are the annealing temperatures very different on the HiSeq and MiSeq?

                Comment

                • TonyBrooks
                  Senior Member
                  • Jun 2009
                  • 303

                  #23
                  See this document (taken from an Illumina bulletin on their website).
                  Attached Files

                  Comment

                  • uberfinch
                    Junior Member
                    • Dec 2011
                    • 8

                    #24
                    MiSeq fail with Nextera adapters

                    I used the following adapters on our MiSeq:

                    N701:
                    CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

                    N501:
                    AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

                    It didn't detect clusters (I used the provided sequencing primers).

                    Anyone have any ideas of what went wrong? I'm dumbfounded.

                    Comment

                    • pmiguel
                      Senior Member
                      • Aug 2008
                      • 2328

                      #25
                      Originally posted by uberfinch View Post
                      I used the following adapters on our MiSeq:

                      N701:
                      CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

                      N501:
                      AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

                      It didn't detect clusters (I used the provided sequencing primers).

                      Anyone have any ideas of what went wrong? I'm dumbfounded.
                      I guess I don't understand your strategy.
                      Looks to me like clusters should have formed, but I don't see anywhere for the standard sequencing primers to anneal. Which would make the clusters undetectable unless you added custom sequencing primer. If you did add custom sequencing primer, does it have an annealing temp of 65 oC (or higher)? The Illumina document that Tony attached above points out that primers with lower annealing temps might not work.

                      Eg, your i5 adapter:

                      AATGATACGGCGACCACCGAGATCTACA | CTAGATCG | CTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
                      Flow cell binding----------- | index??? | ?____________________what is this?


                      Oh wait, that is the old Nextera transposase sequence. Guess Illumina does not include it in their standard i5 primer cocktail. You would have to spike it in.

                      --
                      Phillip
                      Last edited by pmiguel; 07-27-2012, 03:55 AM.

                      Comment

                      • uberfinch
                        Junior Member
                        • Dec 2011
                        • 8

                        #26
                        Thanks for your reply Philip. Yes, as you surmised those 19 bp on the end are the nextera sequence taken from the sequence reported in Illumina's letter for version 2. To make absolutely sure it was right I TOPO cloned a library made with the Nextera XT kit that is supposedly compatible with the miseq on got that exact adapter sequence.

                        Is there any reason to believe the PCR primers for nextera are somehow modified?

                        Comment

                        • pmiguel
                          Senior Member
                          • Aug 2008
                          • 2328

                          #27
                          PCR primers? No.
                          It is the internal segment, closest to the "insert" that has been replaced in the Illumina Nextera kits.
                          Details in the "Illumina Customer Sequence Letter".
                          Again, I think you probably did get clusters on your flow cell. They just were invisible because Illumina sequencers only detect clusters to which a read1 sequencing primers can anneal.

                          --
                          Phillip

                          Comment

                          • pmiguel
                            Senior Member
                            • Aug 2008
                            • 2328

                            #28
                            Originally posted by uberfinch View Post
                            To make absolutely sure it was right I TOPO cloned a library made with the Nextera XT kit that is supposedly compatible with the miseq on got that exact adapter sequence.
                            Are you sure it was a Nextera XT kit, not an old (possibly Epicentre) Nextera kit that you topo cloned and Sanger sequenced?

                            --
                            Phillip

                            Comment

                            • uberfinch
                              Junior Member
                              • Dec 2011
                              • 8

                              #29
                              Yes, I'm positive it is a Nextera XT kit (just bought it!). If you look on the illumina letter, those sequences are from the Illumina V.2 nextera kits.

                              Anyway I guess there isn't a good explanation for why it didn't work. Maybe I'll just have to risk burning another kit! There's only so many times you can stare at the sequences looking for an error.

                              Comment

                              • pmiguel
                                Senior Member
                                • Aug 2008
                                • 2328

                                #30
                                Okay, my mistake. Your adapters should be fine.
                                Is this just a normal NexteraXT kit library, or a set of amplicons you constructed in another manner to mimic the structure of a Nextera library?

                                We just did a MiSeq run on a NexteraXT library (our first Nextera run). It worked. I even spiked in 30% phiX, just in case. (Denature the normal, NaOH way, diluted to 8pM and mixed 30:70 vol:vol with the heat denatured NexteraXT library.)

                                Actually, that was our second Nextera run. We ran the same library (no phiX) the previous day on another MiSeq and it terminated prematurely (crashed) without imaging apparently. Maybe I should have mentioned this earlier? But I was pretty sure this was a fluidics issue because the instrument failed a subsequent volume test.

                                --
                                Phillip

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  Yesterday, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Yesterday, 11:10 AM
                                0 responses
                                9 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-13-2026, 10:26 AM
                                0 responses
                                30 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-09-2026, 10:04 AM
                                0 responses
                                41 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-08-2026, 10:08 AM
                                0 responses
                                26 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...