View Single Post
Old 08-07-2012, 03:13 AM   #2
Location: Leiden

Join Date: Jun 2009
Posts: 10


I'm trying to improve a 1.6 GB genome with Pacbio data. Celera read correction is slow and so I welcome your effort. I am trying to run LSC 0.2 but encounter problems. First, in some of the scripts that make up LSC the first line is #!/home/stow/swtree/bin/python2.6 Changing this to #!/usr/bin/python helped to get rid of some error messages.
Secondly, I installed novoalign v2.08 as suggested to do the alignments. In the script the aligner is called with no option for the output format. So novoalign produces their native format. In the next script however, the expected format is, I assume, the SAM format. So I added -o SAM to the option list in line 207 of (also had to add the path to novoalign because it would not run), and this got me to the next problem in This script looks at the first character of the line in the nav file at line 78 and line 127 of this script. In my version of the nav file the file header character is @ instead of # so I changed this. Now the desired .map file is produced but with only one column of numbers. I know I have short reads aligned so I think I should have more columns. Could you please comment on this? I paste below an example of my SAM output which is different from the example in your script

Many thanks, Hans Jansen

@HD	VN:1.0	SO:unsorted
@PG	ID:novoalign	PN:novoalign	VN:V2.08.02	CL:novoalign -r All -F FA -o SAM -d /mnt/scrap_disk/temp2/pseudochr_LR.fa.cps.nix -f /mnt/scrap_disk/temp2/
@SQ	SN:Pac1	AS:pseudochr_LR.fa.cps.nix	LN:50000716
@SQ	SN:Pac2	AS:pseudochr_LR.fa.cps.nix	LN:50000772
@SQ	SN:Pac3	AS:pseudochr_LR.fa.cps.nix	LN:50002188
@SQ	SN:Pac4	AS:pseudochr_LR.fa.cps.nix	LN:50000094
@SQ	SN:Pac5	AS:pseudochr_LR.fa.cps.nix	LN:50001433
@SQ	SN:Pac6	AS:pseudochr_LR.fa.cps.nix	LN:50001526
@SQ	SN:Pac7	AS:pseudochr_LR.fa.cps.nix	LN:50001210
@SQ	SN:Pac8	AS:pseudochr_LR.fa.cps.nix	LN:50000056
@SQ	SN:Pac9	AS:pseudochr_LR.fa.cps.nix	LN:50000143
@SQ	SN:Pac10	AS:pseudochr_LR.fa.cps.nix	LN:50002588
@SQ	SN:Pac11	AS:pseudochr_LR.fa.cps.nix	LN:50001867
@SQ	SN:Pac12	AS:pseudochr_LR.fa.cps.nix	LN:50000245
@SQ	SN:Pac13	AS:pseudochr_LR.fa.cps.nix	LN:28473695
ILLUMINA-52179E:60:FC70G0LAAXX:6:77:7018:2483	0	Pac10	4706429	2	28M1I16M1I29M1S	*	0	0	ATAGTATCACTGCATACTATCATCTCAGCTGCTCTGCACTGCTGACTGTACTCGCTGCAGTATATCTATGATGTAT	*	PG:Z:novoalign	AS:i:122	UQ:i:122	NM:i:2	MD:Z:73	CC:Z:Pac7	CP:i:31267643	ZS:Z:R	ZN:i:2	NH:i:2	HI:i:1	IH:i:2
ILLUMINA-52179E:60:FC70G0LAAXX:6:77:7018:2483	256	Pac7	31267643	2	6M1I21M1I47M	*	0	0	ATAGTATCACTGCATACTATCATCTCAGCTGCTCTGCACTGCTGACTGTACTCGCTGCAGTATATCTATGATGTAT	*	PG:Z:novoalign	AS:i:122	UQ:i:122	NM:i:3	MD:Z:43G30	ZS:Z:R	ZN:i:2	NH:i:2	HI:i:2	IH:i:2

Last edited by ZFHans; 08-07-2012 at 04:33 AM.
ZFHans is offline   Reply With Quote