Questions about solexa quality score！

[baohua100]

reads.fq file:

@4:1:518:715
GATACCATAAAAGCTGGATCCTTCTTCAAGCATAA
+4:1:518:715
hhhhhhhhhhhhhhhdhhhhhhhhhhhdRehdhhP

1. How to change character (like 'e' or 'h') to quality score?

2. What's the meaning of this score? How to compute this score （ formula ）？

[Farhat]

For a Fastq file, if the quality character is $q the corresponding Phred quality can be calculated with the following Perl code:

$Q = ord($q) - 33;

[SoupDragon]

This is correct if you are using quality scores encoded in "fastq" format. I believe the Illimina pipeline used a different ascii offset (64) according to their pipeline documentation. A value of zero = ascii 64 ('@'). The ascii value for a qv is therefore qv+64. So "h" = 104 - 64 = 40

[Farhat]

Dupe. Deleted.

[Farhat]

This is correct if you are using quality scores encoded in "fastq" format. I believe the Illimina pipeline used a different ascii offset (64) according to their pipeline documentation. A value of zero = ascii 64 ('@'). The ascii value for a qv is therefore qv+64. So "h" = 104 - 64 = 40

You are right. 'h' would make the quality way beyond 40 by my calculation.

[baohua100]

Thanks.

what's the range of this score ? (0---40 ?)

what's the meaning of this score?

[sparks]

Solexa Quality Score

The range is from -5 to 40

If P is probability of base then Solexa quality is 10 log10(P/(1-P))

A quality of -5 corresponds to P=0.25

[Farhat]

The range is from -5 to 40

If P is probability of base then Solexa quality is 10 log10(P/(1-P))

A quality of -5 corresponds to P=0.25

In my datasets the range has been from -40 to 40.

[sparks]

Quality Score Range

Farhats right for Solexa prb file formats from the base caller but for fastq format files the OP asked about, the range should be -5 to 40

[Farhat]

Farhats right for Solexa prb file formats from the base caller but for fastq format files the OP asked about, the range should be -5 to 40

Yes, that's right, because for solexa PRB file the probability of A,C,G or T is given separately, and can be really low, whereas for fastq the lowest probability is 0.25 implying equal probability for any nucleotide.

[baohua100]

$sQ = -10 * log($e / (1 - $e))

when $sQ =40, $e=0.0001

when $sQ=0, $e=0.5

0.5>0.25


when $sQ=-4 $e=0.72



what's the probalibity of error?????????????????????????????

[sparks]

If you are talking fastq format and have a quality of -4 then the probability of the base called is 0.28 and probability it is anyone of the other 3 bases is 0.72.

If you see a -4 in a prb format file then the probability of the base is 0.28 and the other bases will each have their own prb/qual value.

[mikertesz]

"quala" files

The output of a Solexa run generated a "quala" file of the following format:

>sequence_0
40 40 40 19 7 40 40 40 40 40 31 40 40 40 40 40 40 40 40 40 40 11 40 40 40
36 40 12 40 21 39 1 4 40 40 15 40 40 4 40 40 10 40 40 40 40 40 2 4 10
1

>sequence_1
40 40 8 13 12 40 40 40 40 17 27 40 25 17 4 40 40 40 21 40 40 37 40 40 37
4 40 33 40 25 40 3 20 40 40 20 40 40 4 40 8 7 40 40 15 4 10 1 5 20
1

etc...

Does anybody know what those numbers mean? Are those simply the Solexa quality scores per base-pair? The range seems to be 1-40 --- why isn't it -5 to 40 as in fasq?

[vruotti]

Fastq file outside of GERALD

Hi,
Does anyone know an easy way or an existing program to convert all the .prb files from one particular lane into one fastq file? Similar to the s_1_sequence.txt file but with no filters applied?
We have trying hacking around the Perl scripts within GERALD but looks like you need an intermediate seqpre.tmp file which I think gets deleted after the completion of GERALD.

We know this is possible by just running GERALD with the fastq parameter. However, we would like to generate a fastq file that is not affected by GERALD's filters. That way we can set up our own quality filters.

Any ideas?
Do I go ahead and write one?

Thanks,
Victor

[swbarnes2]

I made my own very simple script, but here's a script of James Bonfield's here:

http://seqanswers.com/forums/showthread.php?t=282

The only problem ithat I see is this line

foreach (glob("$fn/*seq.txt")) {

which is going to get every single .seq in the directory, not just the ones from a single lane. So you'll have to fix that.