Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • ECO
    --Site Admin--
    • Oct 2007
    • 1360

    Do not use "adapter trimming" in MiSeq Reporter 2.0.25

    We've identified what appears to be a severe bug in adapter trimming in the newest version of MSR (2.0.25). The sample sheet (generated by Experiment manager 1.3, by default) specifies an adapter sequence to trim from the FASTQs.

    The sequence that is specified is only 20bp of one side ( ) of the TruSeq adapter..."AGATCGGAAGAGCACACGTC"...but the trimming is so promiscuous that reads from several regions of the genome (that I've found so far) are getting trimmed at the genomic location. I haven't had time to further characterize the effect, but I've just shut off adapter trimming as it seems like it was developed and tested against a less complex genome than human *cough*phiX*cough*.

    We first noticed the problem in CFTR exon 10, see the phenotype in the IGV screenshot below, where the same run was put through MSReporter with and without adapter trimming. I'll let you guess which is which. Note that only the R1's are trimmed...R2s from the same cluster aren't (because only one side of the TruSeq adapter is specified).



    Another example in another gene:



    ...zoomed in to see the sequence:



    Looking at the directionality of trimming and manually aligning the genomic location to the MSR trimming sequence, it seems immediately evident what's going on...and that it is indeed promiscuous adapter trimming...that somehow is trimming when there is 5-6 mismatches over 20bp.



    Anyway, just thought I'd share...make sure to turn that off. And trust no one with trimming.
  • ScottC
    Senior Member
    • Jan 2008
    • 244

    #2
    FYI: According to Illumina, the MiSeq used ELAND prior to V2 of MSR, and now uses BWA to do the adapter trimming/masking.

    Comment

    • garyb
      Junior Member
      • Sep 2012
      • 5

      #3
      MiSeq Reporter (MSR) current version is 2.0.26

      Please note that the MSR v2.0.25 is no longer current and MSR v2.0.26 should be installed.

      MSR v2.0.26 addresses various software bugs.

      Contact your local Illumina FAS or call Illumina Technical Support 858-202-4500 to schedule the software upgrade on your MiSeq system.

      garyb
      an Illumina Customer Support Representative

      Comment

      • JackieBadger
        Senior Member
        • Mar 2009
        • 385

        #4
        Thanks for this. We have the latest MiSeq software update and promiscuous trimming is rampant. Now just have to figure how to re-call fastqs without trimming from the raw data

        Comment

        • garyb
          Junior Member
          • Sep 2012
          • 5

          #5
          Originally posted by JackieBadger View Post
          Thanks for this. We have the latest MiSeq software update and promiscuous trimming is rampant. Now just have to figure how to re-call fastqs without trimming from the raw data
          The Sample Sheet in the MiSeq Analysis run folder can be dynamically edited before an MSR re-queue analysis and the following changes made:

          Delete the Adapter line in the Settings section of the sample sheet.
          Add the OnlyGenerateFASTQ 1 in the Settings section of the sample sheet.

          Save the sample sheet - keep the default name. Re-queue the run in MSR. Only FASTQs will be regenerated without any secondary analysis or trimming.

          garyb
          Illumina Customer Solutions representative

          Comment

          • ECO
            --Site Admin--
            • Oct 2007
            • 1360

            #6
            Originally posted by garyb View Post
            Please note that the MSR v2.0.25 is no longer current and MSR v2.0.26 should be installed.

            MSR v2.0.26 addresses various software bugs.

            Contact your local Illumina FAS or call Illumina Technical Support 858-202-4500 to schedule the software upgrade on your MiSeq system.

            garyb
            an Illumina Customer Support Representative
            2.0.26 doesn't change the adapter trimming, right?

            Comment

            • garyb
              Junior Member
              • Sep 2012
              • 5

              #7
              A software update to MSR software due in October 2012 will address the adapter trimming issue.

              It is best to avoid adapter trimming until then by deletion of the Settings Adapter line in the sample sheet.

              Most users should by now be using the MSR 1.3.16 or higher version. This version in fact generates FASTQs alone as a separate workflow. Use the following sample sheet entries to regenerate the FASTQs:

              Workflow GenerateFASTQ
              Application FASTQ Only

              Make those changes to the sample sheet and requeue for MSR analysis and you should see a full new set of FASTQs without further secondary processing. Typical FASTQ generation time takes approximately 15 minutes or less.

              garyb
              an Illumina Customer Support representative

              Comment

              • ECO
                --Site Admin--
                • Oct 2007
                • 1360

                #8
                Thanks garyb!

                Comment

                • dsobral
                  Member
                  • Jan 2012
                  • 23

                  #9
                  How's the adapter trimming in most recent versions of MSR?

                  Just wandering if the reported "rampant" behavior is under control now.

                  Thanks,
                  Daniel

                  Comment

                  • JackieBadger
                    Senior Member
                    • Mar 2009
                    • 385

                    #10
                    I still wouldn't use it. Illumina stated they had fixed it in one of their upgrades but hadn't. Maybe it is fixed now? I much prefer to look at the data myself and process it so I know exactly what has been done to it

                    Comment

                    Latest Articles

                    Collapse

                    ad_right_rmr

                    Collapse

                    News

                    Collapse

                    Topics Statistics Last Post
                    Started by SEQadmin2, 06-09-2026, 11:58 AM
                    0 responses
                    14 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 06-05-2026, 10:09 AM
                    0 responses
                    26 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 06-04-2026, 08:59 AM
                    0 responses
                    36 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 06-02-2026, 12:03 PM
                    0 responses
                    60 views
                    0 reactions
                    Last Post SEQadmin2  
                    Working...