Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • mscholz
    Member
    • May 2010
    • 13

    Newbler with fastq from sff

    I know this is an odd request, but here goes:

    I want to be able to extract an 8KB sff to paired fastq files, and then assemble those fastqs through newbler (I know, it's not recommended, but bear with me). thus far, no matter how I do this, I have not been able to get newbler to treat these as paired ends. I have tried the workarounds I can find when referring to illumina pe data (#0/1 #0/1 as trailing), as well as any other tricks I can figure out.

    Does anyone have any advice on this?

    Thanks!

    =matt
  • nickloman
    Senior Member
    • Jul 2009
    • 355

    #2
    I'm not sure you'll be able to do this (as in, not sure if you can trick Newbler into using FASTQ for scaffolding). I might be wrong. Why do you want to do this?

    But assuming it is possible, have you checked the orientation of the reads is correct for Illumina paired-end data, e.g. you might need to check that first read is forward and the second is reverse.

    Also it's usually /1 /2 as suffixes.

    Comment

    • mscholz
      Member
      • May 2010
      • 13

      #3
      So, we HAVE used illumina PE data for newbler using /1 /2 suffixes, and it's perfectly happy to treat them as paired reads. I'm not sure if newbler is also looking for some other character (illumina read names have a ton of colons in them, e.g.) in the naming to make it check for pairs.

      From what I've read orientation for paired fastq needs to be inward facing, not sure if that orientation is generated for our set, but that would break out during the assembly, not during the read QC, which is where the reporting of # of paired reads used from each library is read in.....

      Comment

      • nickloman
        Senior Member
        • Jul 2009
        • 355

        #4
        Originally posted by mscholz View Post
        So, we HAVE used illumina PE data for newbler using /1 /2 suffixes, and it's perfectly happy to treat them as paired reads. I'm not sure if newbler is also looking for some other character (illumina read names have a ton of colons in them, e.g.) in the naming to make it check for pairs.
        Yes, I have too. The newer header format (Illumina 1.8+) with colons isn't compatible, here's a blog post about how to convert to the older format:

        One unfortunate drawback of working with Illumina sequences is the many changes to the format of their fastq readfiles. The quality scoring has been changed several times since the first Solexa rea…


        From what I've read orientation for paired fastq needs to be inward facing, not sure if that orientation is generated for our set, but that would break out during the assembly, not during the read QC, which is where the reporting of # of paired reads used from each library is read in.....
        OK, maybe you can post the top bit of your 454NewblerMetrics.txt file as this helps with debugging. The other possibility is that your sequences are too short.

        I note you didn't say why you wanted to do this. Just to say that if you wanted to use Newbler with SFF files from another - competing - platform with different mate-pair linker sequences, then there is a hacky way of doing this.

        Comment

        • mscholz
          Member
          • May 2010
          • 13

          #5
          Wait wait wait!

          These are native 454 sffs that are being extracted from 454 runs. I haven't bothered letting a run go to completion for a while, since the first outputs during qc to the command line are whether read sets are being treated as paired or not.

          The reasoning is convoluted, but involves using multiple library sets into newbler, of which the 8kB library may or may not be 454 data, so our informatics team would prefer to have the pipeline stable regardless of the sequencing type for the 8kb library. That means that all sffs have to go to fastqs for this to work. as far as I can tell the method you sent the link to works great for illumina data into newbler, but doesn't seem to work in any permutation for extracted and adapter split 454 reads.

          If you really think that the length of the 454 subreads may be causing the problem I can size filter and try again, but it really looks to my unpracticed eye that it has something to do with the headers.

          Once I have a completed run, I'll be happy to post the metrics file. In the meantime, this is what the headers currently look like:

          sff ->fastq edit (read truncated for visibility)
          @HK0J9ML02GGB5G#0/1
          CGCGAGGAAATACGGTCGACGCGGGCGGCGATCAC
          +
          88?=444<;;9698<<8444??444422@@???ABB==
          @HK0J9ML02IA4J3#0/1

          Comment

          • flxlex
            Moderator
            • Nov 2008
            • 412

            #6
            Newbler will not check for the linker in fastq files, so you'll have to provide the forward and reverse reads separately - this much I think you already know. You could use either newbler itself to split the reads (best option), or the sff_extract tool. For the first case, run newbler with your 8kb sff file and the '-tr flag, and look for the 454TrimmedReads.fna and qual files.

            For mate pairs, I recommend using the -p option to force newbler to treat them as such. I don't think it will work with fastq files, even when set up corrrectly.
            The headers need to be adjusted as per http://contig.wordpress.com/2011/01/...her-platforms/, or when you run sff_extract as per http://flxlexblog.wordpress.com/2012...substr-mg1655/

            Comment

            • nickloman
              Senior Member
              • Jul 2009
              • 355

              #7
              Yes, for my own edification I just tried this:

              test.fastq
              Code:
              @test1/1
              ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
              +
              IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
              @test1/2
              ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
              +
              IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
              @test2/1
              ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
              +
              IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
              @test2/2
              ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
              +
              IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
              Code:
              runAssembly test.fastq
              Created assembly project directory P_2012_10_31_10_52_07_runAssembly
              1 read file successfully added.
                  test.fastq  (Fastq dataset, with standard scores)
              Doesn't work ... but if you fake up Illumina headers (test2.fastq):

              Code:
              @HWI-0001_0001_AAAAAA:1:1:1:1#ATCACG/1
              ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
              +
              IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
              @HWI-0001_0001_AAAAAA:1:1:1:1#ATCACG/2
              ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
              +
              IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
              @HWI-0001_0001_AAAAAA:1:1:1:2#ATCACG/1
              ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
              +
              IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
              @HWI-0001_0001_AAAAAA:1:1:1:2#ATCACG/2
              ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
              +
              IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
              Code:
              runAssembly test2.fastq
              Created assembly project directory P_2012_10_31_10_53_56_runAssembly
              1 read file successfully added.
                  test.fastq  (Illumina paired-end dataset, with standard scores)
              Assembly computation starting at: Wed Oct 31 10:53:56 2012  (v2.6 (20110517_1502))
              Indexing test.fastq (with quality scores)...
                -> 4 reads, 304 bases, 4 marked as matepairs.
              It does ...

              If you go back to the first version and add -p as Lex says, it does add it as a paired-end dataset, but doesn't mark the reads as mate-pairs:

              Code:
              runAssembly -p test.fastq
              Created assembly project directory P_2012_10_31_10_55_01_runAssembly
              1 read file successfully added as explicit paired-end files.
                  test.fastq  (Fastq paired-end dataset, with standard scores)
              Assembly computation starting at: Wed Oct 31 10:55:01 2012  (v2.6 (20110517_1502))
              Indexing test.fastq (with quality scores)...
                -> 4 reads, 304 bases.
              Interesting!

              Comment

              • nickloman
                Senior Member
                • Jul 2009
                • 355

                #8
                Originally posted by mscholz View Post
                The reasoning is convoluted, but involves using multiple library sets into newbler, of which the 8kB library may or may not be 454 data, so our informatics team would prefer to have the pipeline stable regardless of the sequencing type for the 8kb library.
                Separately, I'd suggest always using SFF files with Newbler when they are available due to the additional signal information contained in the flowgrams. Tends to give better results.

                Comment

                Latest Articles

                Collapse

                • GATTACAT
                  Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                  by GATTACAT
                  Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                  Today, 11:43 AM
                • SEQadmin2
                  Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                  by SEQadmin2


                  I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                  Here are nine questions we think about, in roughly the order they matter, before...
                  06-18-2026, 07:11 AM
                • SEQadmin2
                  From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
                  by SEQadmin2


                  Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


                  The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
                  ...
                  06-02-2026, 10:05 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, Yesterday, 05:37 AM
                0 responses
                7 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 06-26-2026, 11:10 AM
                0 responses
                17 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 06-17-2026, 06:09 AM
                0 responses
                52 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 06-09-2026, 11:58 AM
                0 responses
                110 views
                0 reactions
                Last Post SEQadmin2  
                Working...