Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • lmma
    Junior Member
    • Mar 2012
    • 2

    #1

    Miseq Custom primer for 16s V1V3 region

    Hi Guys,
    I am trying to come up with my own amplification and sequencing primers for 16s V1V3 region and I would like to get help with primer design.
    I think Caporaso primer for V4 region is a good start to do modifications on. I want to understand how the primer pad was designed. In his paper, the explanation for pad region is "The amplification and sequencing primers additionally contain a new pad region to avoid primer-dimer formation with the modified adapter. " But I still don't know how to adapt this for other variable regions. Any ideas?


    515F (forward primer) PCR primer sequence:
    Field number (space-delimited), description:
    1, 5' Illumina adapter
    2, Forward primer pad
    3, Forward primer linker
    4, Forward primer

    AATGATACGGCGACCACCGAGATCTACAC TATGGTAATT GT GTGCCAGCMGCCGCGGTAA

    806R (reverse primer) PCR primer sequence (each sequence contains different barcode):
    2168 GoLay barcoded reverse PCR primers. Each primer is followed by a barcode identifier
    generated specifically for this set of primers.
    Field number (space-delimited), description:
    1, Reverse complement of 3′ Illumina adapter
    2, Golay barcode
    3, Reverse primer pad
    4, Reverse primer linker
    5, Reverse primer
    CAAGCAGAAGACGGCATACGAGAT TCCCTTGTCTCC AGTCAGTCAG CC GGACTACHVGGGTWTCTAAT 806rcbc0

    Read 1: (TATGGTAATTGTGTGCCAGCMGCCGCGGTAA)
    Index: (ATTAGAWACCCBDGTAGTCCGGCTGACTGACT)
    Read 2: (AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT)
    Last edited by lmma; 11-13-2012, 09:29 AM.
  • kkrishnan
    Junior Member
    • Nov 2012
    • 5

    #2
    Hi Imma,
    Just wondering if you have attempted and succeeded in designing primers for the V1V3 regions? I am about to try the same and any help would be great! Thanks!

    Comment

    • csquared
      Member
      • May 2008
      • 67

      #3
      The Caporaso primers are great primers and an elegant design. If you want to cover V1-V3 rather than V4, you can make an easy change to use 27F and 534R from the human microbiome project:

      27F Forward
      AATGATACGGCGACCACCGAGATCTACAC TATGGTAATT GT AGAGTTTGATCCTGGCTCAG

      534R Reverse (rcbc0)
      CAAGCAGAAGACGGCATACGAGAT TCCCTTGTCTCC AGTCAGTCAG CC ATTACCGCGGCTGCTGG

      Read 1: (TATGGTAATTGTAGAGTTTGATCCTGGCTCAG)
      Index: (CCAGCAGCCGCGGTAATGGCTGACTGACT)
      Read 2: (AGTCAGTCAGCCATTACCGCGGCTGCTGG)

      Please verify all of the above sequences. I did the conversion a bit quickly but they should be correct.
      HudsonAlpha Institute for Biotechnology
      http://www.hudsonalpha.org/gsl

      Comment

      • lmma
        Junior Member
        • Mar 2012
        • 2

        #4
        Thanks for your replies and suggestions. I am currently validating my primers that are very similar to Caporaso primers with Miseq and will update you shortly.

        Comment

        • liepa
          Junior Member
          • Sep 2012
          • 4

          #5
          Originally posted by lmma View Post
          Thanks for your replies and suggestions. I am currently validating my primers that are very similar to Caporaso primers with Miseq and will update you shortly.
          It would be interesting to know your results as I was thinking of the same "easy convertion" and usage of V1V3 primers from 454 sequencing? Would you consider using only one index?
          Last edited by liepa; 01-21-2013, 07:18 AM.

          Comment

          • fozrun
            Junior Member
            • Jan 2010
            • 6

            #6
            validating primers

            Originally posted by lmma View Post
            Thanks for your replies and suggestions. I am currently validating my primers that are very similar to Caporaso primers with Miseq and will update you shortly.
            Hi Imma:

            Did you get your primers to work? Do they have the staggered pad so that you don't need to use PhiX? I can't seem to get e-mail or messaging to work. We're soon taking delivery of a MiSeq and want to get prepared.

            Could you e-mail me at forsterr at agr dot gc dot ca

            Thanks.

            Comment

            • lotijeo
              Junior Member
              • Apr 2013
              • 3

              #7
              MiSeq amplicon paired-end libraries

              Hi Imma,
              I was wondering you got any positive results using the protocol from Caporaso et al 2012. I would also like to adopt the same approach and customize some gene-specific primers using their approach. Any insights would be very appreciated.
              Thanks

              Comment

              • rohan_dandage
                Junior Member
                • Oct 2014
                • 3

                #8
                Hello,
                I have a related query. I am set out to do an amplicon sequencing on miseq. Going through the library architectures (Illumina TruSeq DNA Adapters De-Mystified Illumina - all flavors) and adapter sequences (Illumina Customer Sequence Letter (August 12, 2014)), I have designed a strategy involving 3 simple PCR steps which skips all of recommended-kit-based-library preparation. Please have a look.

                where,
                P5: part of adapter that attaches to flowcell 29 nt :AATGATACGGCGACCACCGAGATCTACAC
                P7: part of adapter that attaches to flowcell 24 nt :CAAGCAGAAGACGGCATACGAGAT
                Read 1 : sequencing primer 33nt :ACACTCTTTCCCTACACGACGCTCTTCCGATCT
                Read 2: sequencing primer 33nt :GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
                i5 :barcode 8nt
                i7 : barcode 8nt

                PCR1: For primer:ACACTCTTTCCCTACACGACGCTCTTCCGATCT<template for 10bp>
                PCR1: Rev primer:GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC<template rev 10bp>
                PCR2: For primer:GATCTACAC<i5 8nt>ACACTCTTT
                PCR2: Rev primer:ATACGAGAT<i7 8nt>GTGACTGGA
                PCR3: For primer:P5
                PCR3: Rev primer:P7

                For plexing 48 samples I would require only 24 (2+12(i5) +8(i7) +2) primers, a standard high fidelity pol and gel purification. I am very skeptical about mainly because of posts mentioning that illumina adapters are methylated so custom primers dont work and also the fact that if the process was so simple, the expensive kits may not be existing!
                If anybody has any idea whether this kind of tinkering works or not, please let me know. As a test I will be doping a single such library next week. I would let know the result. Thanks.
                Last edited by rohan_dandage; 01-11-2015, 04:38 PM.

                Comment

                • JBKri
                  Member
                  • Jan 2014
                  • 80

                  #9
                  Originally posted by rohan_dandage View Post

                  For plexing 48 samples I would require only 24 (2+12(i5) +8(i7) +2) primers, a standard high fidelity pol and gel purification. I am very skeptical about mainly because of posts mentioning that illumina adapters are methylated so custom primers dont work and also the fact that if the process was so simple, the expensive kits may not be existing!
                  If anybody has any idea whether this kind of tinkering works or not, please let me know. As a test I will be doping a single such library next week. I would let know the result. Thanks.
                  Did you try it? Did it work?
                  Jon

                  Comment

                  • rohan_dandage
                    Junior Member
                    • Oct 2014
                    • 3

                    #10
                    @JBKri: I did not try actually. As ILMN won't support such strategies, I am still seeking for expert advise first.

                    Comment

                    • hadarneuman
                      Junior Member
                      • Feb 2015
                      • 1

                      #11
                      Has anyone actually used the 27F primer for Miseq? My runs didn't succeed, probably due to low Tm and low GC content of the Caporaso Read1 primer (TATGGTAATT TC AGAGTTTGATCCTGGCTCAG)... Any ideas of how to change the primer pad in order to add more GC content?
                      Thanks!
                      Hadar

                      Comment

                      • bunce
                        Member
                        • Sep 2012
                        • 55

                        #12
                        Hi Hadarneuman, I would look into using locked-nucleic acid (LNA's) embedded into your sequencing primer. Fluidigm use it (e.g. A+CA+CTG+ACGACATGGTTCTACA) to artificially raise the Tm of the sequencing primer. We have found LNA-custom primers work fine - consensus seems to be to put the LNA bases at the 5' end. They are expensive but worth it if you are planning on doing a lot of sequencing with the single assay. Check out this link for more info; http://www.exiqon.com/lna-technology
                        Cheers, Mike

                        Comment

                        • nangel
                          Member
                          • Nov 2014
                          • 15

                          #13
                          We routinely use 27F primer for Miseq (AGAGTTTGATCMTGGCTCAG). Haven't had any issues when compared to other primer sets that we have in use. When you say that your runs didn't succeed is it in failure to cluster in the sequencing run? We get usual cluster numbers and Q scores. Sample type makes a big difference in amplicon generation obviously.

                          Comment

                          Latest Articles

                          Collapse

                          • SEQadmin2
                            Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                            by SEQadmin2



                            CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                            Despite this, “CRISPR helped turn genome editing from a specialized technique into
                            ...
                            07-31-2026, 11:01 AM
                          • SEQadmin2
                            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                            by SEQadmin2


                            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                            The systematic characterization of the human proteome has
                            ...
                            07-20-2026, 11:48 AM

                          ad_right_rmr

                          Collapse

                          News

                          Collapse

                          Topics Statistics Last Post
                          Started by SEQadmin2, Yesterday, 10:05 AM
                          0 responses
                          8 views
                          0 reactions
                          Last Post SEQadmin2  
                          Started by SEQadmin2, 08-13-2026, 12:22 PM
                          0 responses
                          33 views
                          0 reactions
                          Last Post SEQadmin2  
                          Started by SEQadmin2, 08-11-2026, 10:35 AM
                          0 responses
                          27 views
                          0 reactions
                          Last Post SEQadmin2  
                          Started by SEQadmin2, 08-06-2026, 07:41 AM
                          0 responses
                          38 views
                          0 reactions
                          Last Post SEQadmin2  
                          Working...