How to remove the newlines in pacific biosciences fastq file

[[email protected]]

Hi All,

Hope someone could help me out here.
I am trying to analyze a pacbio data set. Because of long reads, the sequences and quality scores have multiple lines with 51 characters per line. When I ran this through fastqc to check quality and statistics, it complains about the format because there are multiple lines. My question is how I can concatenate the sequence into one line and quality score into another line.

Thank you very much!

[Richard Finney]

Please post an example of the data you need to fix.

[[email protected]]

Thank! Richard.

An example sequence is below. For the sequence and qualtiy score, there are 5 lines each. I am trying to concatenate them separately.

Orignal format:

@chlamy1234
ATGTGGGCCCAATTTATGTGGGCCCAATTTATGTGGGCC
CAATTTATGTGGGCCCAATTTATGTGGGCCCAATTTATG
GGGCCCAATTTATGTGGGCCCAATTTATGTGGGCCCAAT
TTATGTGGGCCCAATTTATGTGGGCCCAATTTATGTGGG
CCCAATTTATGTGGGCCCAATTTATGTGGGCCCAATTT
+
%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%
^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&
*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^
%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%
^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^$)


format to be converted to:
@chlamy1234
ATGTGGGCCCAATTTATGTGGGCCCAATTTATGTGGGCCCAATTTATGTGGGCCCAATTATGTGGGCCCAATTTATGGGGCCCAATTTATGTGGGCCCAATTTATGTGGGCCCAATTTATGTGGGCCCAATTTATGTGGGCCCAATTTATGTGGGCCCAATTTATGTGGGCCCAATTTATGTGGGCCCAATTT
+
%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^%^&*$%^&^$)

[Richard Finney]

cat filename.fastq| awk '{p=(NR%12); printf "%s",$0 ; if ((p==1)||(p==6)||(p==7)||(p==0)) printf "\n"}' > newfilename.fastq

[[email protected]]

Thank you Richard! As you can tell that I am new in this area. Apparently, it works for this particular example. But I am dealing with about 1 million reads. The length of every reads varies, which means one has five lines long (as this example) and another has 20 lines long. I think there must be a better way to decide which lines needs to be concatenated.

Your help is greatly appreciated.

Stuart

[flxlex]

seqtk to the rescue: https://github.com/lh3/seqtk

seqtk seq -l 0 infile.fastq > outfile.fastq

should do it...

[[email protected]]

Thank you flxlex. will try it out and let you know if it works.

[[email protected]]

It worked perfectly. thanks, flxlex