Adapter Enrichment PCR

[barb]

Hi Solexa community,

Has anybody had the problem of having two bands after the enrichment PCR? The second band is bigger than the band I anticipated to see. Any ideas about what could have caused this?

[cjohns]

If it is about 120bp it is adapter complexes. We had this problem, but solved it by modifiying the size selection part of the protocol.

[barb]

No, it is not at 120bp. My expected bands were at ~250, ~300 and ~350 (I cut several sizes) and then respectively a second band was present at ~400, ~500 and ~633. In the end I just did 3 enrichment pcr reactions, pooled,purified, ran it on a gel, extracted and purified the correct band. I retained enough DNA to submit that sample for sequencing.

[tomv]

If it is about 120bp it is adapter complexes. We had this problem, but solved it by modifiying the size selection part of the protocol.

Can you elaborate on this. We sometimes get a high percentage of "linker" reads in our samples but its not clear to me how they could be forming. If I understand the protocol correctly the linkers should not be able to self anneal. So how does this happen and what does this "adapter complex" look like?

[cjohns]

Hi tomv,

We know that in our first round of sequencing we got a huge amount of product that gave us a spike on our bioanalyzer read (prior to sequencing) that runs at approx 120bp. We didn't know what it was, so we went ahead and put the samples on the Solexa. When we looked at the %base call plots we saw spikes that when one 'reads' them across they have the same sequence as: GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG which is one of Illumina's adapters (what I think you are calling a linker).

On the protocol that UCSC genome center has: http://www.genomecenter.ucdavis.edu/...brary_prep.pdf
they discuss an 'adapter-adapter band' that migrates at 120bp and they mention that cutting out this band during size selection will get rid of this.

I discussed this with one of my colleagues who believes that the adapters are concatenating during ligation. This starts with the two adapters linking together forming chains of different sizes. Then during the amplification step, the chain that is 3 adapters long is most efficiently amplified creating a large amount of 124 bp product.

We solved this problem by increasing the amount of ChIP DNA template and by running a longer agarose gel at slower speeds during the size selection part so that the 'adapter complexes' are separated away from the desired DNA pieces. Since doing this, we have not had this problem again.

[tomv]

Thanks cjons,

This is consistent with what we have seen. When we look at the full 36 base consensus sequence for these adapter reads we actually get the full adaptor sequence, plus the first 4 bases of the adapter again indicating that there are likely at least two copies of that adaptor in the final template.

Interestingly, the two adapter sequences in the read are separated by an "A". I'm sure this is significant in the ligation but I'm not sure how. This is the part that is most puzzling to me. I love to hear if anyone can explain it before I just put it in the old “weird stuff happens” category.

In any case, thanks for the tip about gel purification. We'll see if that helps.

[Hbseq]

2nd larger DNA band after enrichment PCR

No, it is not at 120bp. My expected bands were at ~250, ~300 and ~350 (I cut several sizes) and then respectively a second band was present at ~400, ~500 and ~633. In the end I just did 3 enrichment pcr reactions, pooled,purified, ran it on a gel, extracted and purified the correct band. I retained enough DNA to submit that sample for sequencing.

Hi all, I'm new. I have encountered a similar problem as Barb posted before. Basically after enrichment PCR, I got 2 bands on agarose gel. One band is about the expected size, the other is of larger size, usually ~200bp bigger. I've tried different ways but can't solve the problem yet. Any help is appreciated! -Hbseq

[andibody]

Hi,
We have observed this second band or peak too.
Also it is double the size of the expected one. Cutting during size selection at 200 bp will result in two peaks one at 200bp the second at 400bp indicating the formation of duplicates during PCR.
Surprisingly it doesn't happen each sample prep. Maybe a sample specific problem?

[elaney_k]

Barb, Hbseq & Andibody,

How many cycles are you using for your enrichment PCR? I used to see this using genomic DNA samples with the old library prep protocols that suggested ~18 cycles for the enrichment PCR. I haven't seen the larger band since I dropped the enrichment cycle number to 10-12.

Elaine

[andibody]

I do ChiP-Seq + 18 cycles PCR. Reducing the number of cycles might be a good idea as we have also already seen that we end up anyhow being out of exponential enrichment when performing 18 cycles.
We'll give it a try.
Thanks

[Hbseq]

Thanks for the responses. It doesn't appeared to be sample specific on my side. However, reducing PCR cycles or DNA template amount helped to reduce the intensity of the larger MW DNA band. Increasing annealing temperature had the reverse effect. I used 18 cycle PCR for enrichment.

[cnicolet]

Hi:
I think the larger band is some kind of single strand product, possibly generated from asymmetric PCR at the last library prep step (our main reason for this conclusion is that we can generate them by heating a library that has run as a single band previously). Sometimes we see strong ones, sometimes we don't and it doesn't always correlate with cycle number. Sometimes the products are laddered, but sometimes they show up as very high molecular weight smears. Agilent claims the bioanalyzer dye won't recognize SS, but either there's residual reactivity or the single strand forms are "conformers' of some kind with intramolecular base pairing. The main problem we find with these is that they mess up the quantitation of the library--I'm pretty sure they will form sequencable clusters, but is their fluorescence reflective of the amount that's there? We don't think they are weird chimeras that would mess up an assembly, but don't have direct data for that.

Charlie

[mollusc]

our main reason for this conclusion is that we can generate them by heating a library that has run as a single band previously. Agilent claims the bioanalyzer dye won't recognize SS, but either there's residual reactivity or the single strand forms are "conformers' of some kind with intramolecular base pairing.

Hi Cnicolet,
Even i see this prob. and i suspect it to be ssDNA,buti have got no basis to confirm.Could you please elaborate how you concluded this and also about the conformers thing you mentioned about.
Thanks a lot

[cnicolet]

Hi Mollusc:

A couple of things, first, regarding cycle number--we thought it was overamplification at first but then a comparison of 10 vs 14 cycles showed the exact same intensity ratio between the main band and the faint upper MW band, it's just that both bands were more intense with 14 cycles. So while amplification probably plays a role, it's not the whole story we don't think. My evidence for SS is mostly indirect. As I said, my best evidence is when I heat a library that shows a perfect single band DS library of correct MW and run that, I see a laddered set of high MW bands generated from that library. I start to see it at 65, then it's all I see at 80 --the presumed DS band has completely gone but the laddered bands remain. It also "looks" like SS to me--not a sharp band (or peak, I'm just so used to gels) but more dispersed, fuzzy material that runs higher (like the difference between M13 ss and RF from the OLD days of sequencing). Also, you can imagine that the Tm of the two primers are very different because of the differences in length, so it doesn't seem a stretch to imagine asymmetric PCR occurring. Because intramolecular annealing should happen pretty fast, and we know the ends of the adapters at least are inverted repeats, I again feel it's possible that SS libraries would form hairpins of various kinds that would bind dye but migrate aberrantly.

[elaney_k]

These guys seem to have come across the same problem: http://seqanswers.com/forums/showthread.php?t=2582

I have also performed a second gel-isolation of some of my samples post enrichment PCR when I've had adapter dimers in my samples (extra band ~110bp) which worked well for me so maybe a second gel isolation step is an easy next step?