Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • microgirl123
    Senior Member
    • Jun 2012
    • 199

    Metagenomics (not 16s!)

    Our core facility has many people (with very little money) interested in doing metagenomics on the MiSeq, but they often have different regions of interest. So we're looking for a different way to approach library prep other than the Caporaso approach of using PCR primers that include primers for the region of interest, indices, and Illumina adaptor sequences. This way seems to work well, but is very cost prohibitive since you need to order a separate reverse primer for every sample you want to multiplex. If you only want to do this once, you are paying ~$200 or more per sample for primers. For a set of 20 samples this can add up!

    Has anyone seen or used a method that just ligates the Illumina adaptors/indices onto PCR amplicons? This would allow us to place the problem of actually amplifying the DNA onto our customers (and this is a big deal!) and should drastically save on the cost of library prep for these types of samples.

    Thanks!
  • GW_OK
    Senior Member
    • Sep 2009
    • 411

    #2
    We've made libraries out of amplicons for a few customers. Seemed to work ok. Just treat the amplicon like a pre-sheared sample.

    Comment

    • koadman
      Member
      • May 2010
      • 65

      #3
      Hi microgirl123,
      One way to reduce the primer cost is to use the dual-barcode capabilities of the miseq. You can modify the Caporaso et al 2012 oligos to have a barcode at both ends. I have had successful runs using the following adapter structure:

      Code:
      Fwd primer:
      AATGATACGGCGACCACCGAGATCTACAC [Barcode] TATGGTAATT GT GTGCCAGCMGCCGCGGTAA
      
      Rev primer:
      CAAGCAGAAGACGGCATACGAGAT [Barcode] AGTCAGTCAG CC GGACTACHVGGGTWTCTAAT
      This structure is compatible with the standard miseq dual-index program, e.g. read 1, index 1, index 2, read 2. The standard miseq program uses 8 base barcodes but you could get away with fewer. You would need O(N^0.5) barcodes for N samples.

      Comment

      • Vinz
        Member
        • Dec 2010
        • 80

        #4
        I guess what you are looking for is the 4primer approach: You have outer primers including your indexes and inner primers with your target specific sequence. Outer and inner primers have an overlap. That way you can reuse the outer primers for independent projects and the inner target specific primers are less expensive (~60bases).
        Look in this thread for design of dual indexing:
        Bridged amplification & clustering followed by sequencing by synthesis. (Genome Analyzer / HiSeq / MiSeq)

        These are the parts that we use successfully as overlap regions:
        ACACTCTTTCCCTACACGA
        GTGACTGGAGTTCAGACGTG

        Comment

        • bstamps
          Member
          • Oct 2012
          • 40

          #5
          We designed our primers to have a barcode built into our forward primer- since it only added 12bp to a 15bp primer the cost per-primer wasn't that bad. End results from the run were good...forward read was of high quality, with some issues on the reverse. Still we had enough sequence to do what we needed to do with our amplicon. We had some ideas passed to us from our sequencing provider on how to fix this the next time that we're going to try out. Having a barcode on the reverse as well could help as well (Increase in cost).

          Comment

          • microgirl123
            Senior Member
            • Jun 2012
            • 199

            #6
            Originally posted by GW_OK View Post
            We've made libraries out of amplicons for a few customers. Seemed to work ok. Just treat the amplicon like a pre-sheared sample.
            When you say to treat it like a pre-sheared sample, do you mean that you shear your amplicons?

            We don't want to do that, but I'm wondering if I can just take amplicons that are ~500 bp and ligate on Illumina adapters and indices. Since they're PCR amplicons, shouldn't they already be A-tailed? Otherwise, we could run them through a TruSeq kit for end-repair, A-tailing, and adapter ligation, but adjust the final size selection to keep the right-sized pieces.

            Comment

            • microgirl123
              Senior Member
              • Jun 2012
              • 199

              #7
              Originally posted by Vinz View Post
              I guess what you are looking for is the 4primer approach: You have outer primers including your indexes and inner primers with your target specific sequence. Outer and inner primers have an overlap. That way you can reuse the outer primers for independent projects and the inner target specific primers are less expensive (~60bases).
              Thanks! That might work - we can have customers deal with the inner primers for their region of interest and we just take their PCR amplicons and PCR on the outer primers.

              Comment

              • bstamps
                Member
                • Oct 2012
                • 40

                #8
                Originally posted by microgirl123 View Post
                When you say to treat it like a pre-sheared sample, do you mean that you shear your amplicons?

                We don't want to do that, but I'm wondering if I can just take amplicons that are ~500 bp and ligate on Illumina adapters and indices. Since they're PCR amplicons, shouldn't they already be A-tailed? Otherwise, we could run them through a TruSeq kit for end-repair, A-tailing, and adapter ligation, but adjust the final size selection to keep the right-sized pieces.
                By pre-sheared I think he means your amplicon is already to an insert size that is acceptable to library prep- all fragments are roughly the same size (It being amplicon), so all you need to do is ligate the sequencing adaptors on and go. No need to shear, just prep and sequence.

                Comment

                • microgirl123
                  Senior Member
                  • Jun 2012
                  • 199

                  #9
                  Hi Vinz, do you have any papers or protocols that use this method? It seems like it would be the best approach for us - we'd just need to figure out how to do the actual final PCR (it seems like you wouldn't need many cycles) and how much DNA from the first PCR to ask for in the first place.

                  Comment

                  • Vinz
                    Member
                    • Dec 2010
                    • 80

                    #10
                    We actually include the outer primer in the target specific PCR. However, the PCR should not be tricky. I would do a 1:10 dilution and 5 cycles. I am not aware of a publication even though it probably has been published.
                    Fluidigm documentation includes hints on that approach. Good luck!

                    Comment

                    • GW_OK
                      Senior Member
                      • Sep 2009
                      • 411

                      #11
                      Originally posted by bstamps View Post
                      By pre-sheared I think he means your amplicon is already to an insert size that is acceptable to library prep- all fragments are roughly the same size (It being amplicon), so all you need to do is ligate the sequencing adaptors on and go. No need to shear, just prep and sequence.
                      That's precisely it. It'll be the tightest size selected peak you'll ever make a library out of.

                      Comment

                      • tickseq
                        Junior Member
                        • Feb 2013
                        • 3

                        #12
                        dual indexing

                        Thanks for posting your dual indexing primer sequences. I was planning on using the Nextera barcode sequences but wanted to double check. The Illumina rep said that the posted sequences are the sequences as read by the MiSeq. Does that mean that the 5'-3' barcode sequences on the primer should all be reverse complemented from what Nextera provides?

                        Also, do you have any feelings on standard desalted primers vs HPLC or PAGE purified primers? I've found that people have strong feelings either way but would like to get away with the cheapest method that works.

                        Thanks

                        Originally posted by koadman View Post
                        Hi microgirl123,
                        One way to reduce the primer cost is to use the dual-barcode capabilities of the miseq. You can modify the Caporaso et al 2012 oligos to have a barcode at both ends. I have had successful runs using the following adapter structure:

                        Code:
                        Fwd primer:
                        AATGATACGGCGACCACCGAGATCTACAC [Barcode] TATGGTAATT GT GTGCCAGCMGCCGCGGTAA
                        
                        Rev primer:
                        CAAGCAGAAGACGGCATACGAGAT [Barcode] AGTCAGTCAG CC GGACTACHVGGGTWTCTAAT
                        This structure is compatible with the standard miseq dual-index program, e.g. read 1, index 1, index 2, read 2. The standard miseq program uses 8 base barcodes but you could get away with fewer. You would need O(N^0.5) barcodes for N samples.

                        Comment

                        Latest Articles

                        Collapse

                        • GATTACAT
                          Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                          by GATTACAT
                          Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                          07-01-2026, 11:43 AM
                        • SEQadmin2
                          Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                          by SEQadmin2


                          I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                          Here are nine questions we think about, in roughly the order they matter, before...
                          06-18-2026, 07:11 AM

                        ad_right_rmr

                        Collapse

                        News

                        Collapse

                        Topics Statistics Last Post
                        Started by SEQadmin2, 07-02-2026, 11:08 AM
                        0 responses
                        7 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 06-30-2026, 05:37 AM
                        0 responses
                        12 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 06-26-2026, 11:10 AM
                        0 responses
                        20 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 06-17-2026, 06:09 AM
                        0 responses
                        54 views
                        0 reactions
                        Last Post SEQadmin2  
                        Working...