Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • thedamian
    Member
    • Feb 2012
    • 50

    #1

    UCSC refSeq Gene and hg19 coordinate

    Hello,
    I have a list of mRNA NM_ numers.
    In UCSC, hg19->refGene table, I can get exons and cds coordinates for every NM_.

    However, when I pull out a subsequence from hg19 based on refGene coordinates, the result seems to be not correct for reverse strand. Reverse complement of the pulled exons dosn't work as well.

    -------
    example:
    I have a: NM_012345.3
    From UCSC i know, that for NM_012345 the first CDS is beetwen 50000:50100, strand: "-", chr1
    Then I use:
    Code:
    samtools faidx /path/hg19.fa chr1:50000-50100
    The result doesn't start with ATG (and it should starts).


    Where is the problem? I know that UCSC doesn't use the version (NM_012345 instead of NM_012345.3) but it should work.

    (hg19 is downloaded from http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/)
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    NM_012345 is on chromosome 13 (check the genome browser). I expect you're either reading something wrong or got the wrong refGene table.

    Comment

    • thedamian
      Member
      • Feb 2012
      • 50

      #3
      Originally posted by dpryan View Post
      NM_012345 is on chromosome 13 (check the genome browser). I expect you're either reading something wrong or got the wrong refGene table.
      heh, it was an abstract example 012345 is like abcdef
      I test ~3000 genes in such way. 1600 works good, they are "+" strand.
      ~1400 are "-" and when I use samtools faidx, I can't get correct mRNA, CDS.

      Comment

      • dpryan
        Devon Ryan
        • Jul 2011
        • 3478

        #4
        Ah, in the future, always give working examples

        Remember that anything on the "-" strand should end in ATG (actually, CAT), rather than start with it.

        Comment

        • thedamian
          Member
          • Feb 2012
          • 50

          #5
          ok, real example:
          I have gene IL10, NM_000572.2.
          Based on NM_000572 from UCSC I get:

          name: NM_000572
          chrom: chr1
          strand: -
          txStart: 206940947
          txEnd: 206945839
          cdsStart: 206941980
          cdsEnd: 206945780
          exonStarts: 206940947,206943173,206944251,206944700,206945615,
          exonEnds: 206942073,206943239,206944404,206944760,206945839,
          name2: IL10

          so first CDS is from 206941980 to 206942073

          then I use:
          Code:
          samtools faidx hg19.fa chr1:206941978-206942075
          ( I added +2 to each side because UCSC is 0-based, hg19 1-based)
          the output:
          GTCTCAGTTTCGTATCTTCATTGTCATGTAGGCTTCTATGTAGTTGATGAAGATGTCAAACTCACTCATGGCTTTGTAGATGCCTTTCTCTTGGAGCT

          no ATG, and TAC in here;/

          Comment

          • dpryan
            Devon Ryan
            • Jul 2011
            • 3478

            #6
            It's on the '-' strand, so you're grabbing the end, rather than the beginning

            Comment

            • thedamian
              Member
              • Feb 2012
              • 50

              #7
              Originally posted by dpryan View Post
              It's on the '-' strand, so you're grabbing the end, rather than the beginning
              heh yes, I've just realised it.
              If starnd is "-", start codon is cdsEnd and end codon is cdsStart! Very confusing!
              + 1 to experience

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                by SEQadmin2



                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                ...
                07-31-2026, 11:01 AM
              • SEQadmin2
                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                by SEQadmin2


                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                The systematic characterization of the human proteome has
                ...
                07-20-2026, 11:48 AM
              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, Today, 10:13 AM
              0 responses
              10 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-31-2026, 02:55 AM
              0 responses
              23 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-24-2026, 12:17 PM
              0 responses
              19 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-23-2026, 11:41 AM
              0 responses
              17 views
              0 reactions
              Last Post SEQadmin2  
              Working...