Searching for original genome sequence with PCR primers used for bisulfite sequencing

[kit.]

I have to do bisulfite sequencing and I have searched from literature that, there's primer already available for the region I am interested. I am wondering how can I got the original genome sequence that the PCR amplified?

One of the region I am interested in is H19 in chromosome 11 in human. PCR primers used for amplifying bisulfite-converted DNA was
F: 5'-TGAGTGTTTTATTTTTAGATGATTTT-3'
R: 5'-ACAATACAAACTCACACATCACAAC-3'

Is there any ways that I can search the original genome sequence (not bisulfite converted DNA sequence) that this PCR amplified?

Thanks

[fkrueger]

For the GRCh37 genome build the forward sequence aligns to chr 11, starting at bp 2021077. Here is the SAM entry:
forward_oligo 0 11 2021077 255 26M * 0 0 TGAGTGTTTTATTTTTAGATGATTTT IIIIIIIIIIIIIIIIIIIIIIIIII NM:i:9 XX:Z:7CC4CCC6CCCC XM:Z:.......hh....hhx......hhhx XR:Z:CT XG:Z:CT

I am afraid the reverse primer seems to align to several different places (I think with 1 mismatch), but maybe if you start looking for in a sensible PCR distance from the forward match you'll be lucky.

[swbarnes2]

Did you try in silico PCR on UCSC's genome browser?

[frozenlyse]

Did you try in silico PCR on UCSC's genome browser?

That won't work for bisulfite primers, unless you have a UCSC instance with bisulfite converted genomes loaded - which is annoying for human because you have to make a separate one for each strand. Personally I created BSgenome packages for bisulfite genomes and use R/Bioconductor functions for this kind of stuff.

[C.R.]

You may try http://bisearch.enzim.hu/?m=genompsearch

[PeteH]

Personally I created BSgenome packages for bisulfite genomes and use R/Bioconductor functions for this kind of stuff.

That sounds useful to me; care to share your script for creating these?
Thanks,
Pete

[kit.]

For the GRCh37 genome build the forward sequence aligns to chr 11, starting at bp 2021077. Here is the SAM entry:
forward_oligo 0 11 2021077 255 26M * 0 0 TGAGTGTTTTATTTTTAGATGATTTT IIIIIIIIIIIIIIIIIIIIIIIIII NM:i:9 XX:Z:7CC4CCC6CCCC XM:Z:.......hh....hhx......hhhx XR:Z:CT XG:Z:CT

I am afraid the reverse primer seems to align to several different places (I think with 1 mismatch), but maybe if you start looking for in a sensible PCR distance from the forward match you'll be lucky.

Yes you are correct. This primer has the potential to create mismatch when I search by http://bisearch.enzim.hu/?run. But all of them are located in chromosome 11.

Can you please give me the sequence you found with the shortest length? In literature it mentioned that it would amplify 149bp but I found 125bp only using the website I posted. I just don't know where there's such as difference.

[kit.]

You may try http://bisearch.enzim.hu/?m=genompsearch

I search the primers using the website you mentioned. It turns out that the product size is 125bp, but in literature, the same set of primers would results in a amplicon of 148bp. I am wondering why there's such a difference....