Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • #bases & # reads

    Hi,

    I am new to bioinformatics and appreciate your help answering this question.

    I have a reads file [a sample is attached] and want to count the number of #bases and number of reads in this file, how do I do this? Is there a relation between the #bases and # reads in a reads file? i,e if the #bases information is available for a particular reads file, can I immediately calculate the number of reads?


    Thanks.
    Attached Files

  • #2
    Assuming that all the reads are of a uniform length and have not been modified in some way (trimmed), then each read will be the same number of bases.

    In your sample fastq file:
    HTML Code:
    @SRR019388.1.1 SLXA-EAS1_126_FC20H6L_0_7_1_490_23.1 length=35
    GTCAAATATAGTGAGTACAGGAAAATAGGTGGAGA
    +SRR019388.1.1 SLXA-EAS1_126_FC20H6L_0_7_1_490_23.1 length=35
    <<<<<<<<<<<<;<<<<<<<<<<<<<<9<<;;7<;
    So your reads are 35bps long. If you know the number of reads just multiple by 35 and that equals the number of bases.

    Comment


    • #3
      Originally posted by CS Student View Post
      Hi,

      I am new to bioinformatics and appreciate your help answering this question.

      I have a reads file [a sample is attached] and want to count the number of #bases and number of reads in this file, how do I do this? Is there a relation between the #bases and # reads in a reads file? i,e if the #bases information is available for a particular reads file, can I immediately calculate the number of reads?


      Thanks.
      There are several programs (e.g., get_fasta_stats -- search the forum for them) that will calculate read/base stats. You could also 'wc -l' the fastQ file and divide by 4 for the number of reads. Bases are bit more difficult to find via simple unix tools. Basically I suggest you do more reading and searching in the forum. Always a good way to find out information.

      There is no relation between #bases and #reads.

      Comment


      • #4
        Originally posted by chadn737 View Post
        Assuming that all the reads are of a uniform length and have not been modified in some way (trimmed), then each read will be the same number of bases.
        And that is a big assumption. Sure, you could look at the start of the file and at the end of the file and see reads being 35 bases in length ... but are all? I wouldn't want to guarantee this on an unknown file.

        Actually from the sample file, 'CS student' should be able to figure out how many reads and the length of the reads (since this is given) via simple unix tools --- which any CS student should know. I'd use 'grep', 'cut', 'sort', and 'uniq'.

        Comment


        • #5
          Originally posted by westerman View Post

          Actually from the sample file, 'CS student' should be able to figure out how many reads and the length of the reads (since this is given) via simple unix tools --- which any CS student should know. I'd use 'grep', 'cut', 'sort', and 'uniq'.
          Perhaps "CS Student" needs help understanding the "fastq" file format to follow your suggestion. May be a true beginner (can't tell from looking at "CS Student's" posting history).

          Comment


          • #6
            Thank you very much for your explainations. This is all what I wanted to know about # reads and #bases.

            Comment

            Latest Articles

            Collapse

            • seqadmin
              Current Approaches to Protein Sequencing
              by seqadmin


              Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
              04-04-2024, 04:25 PM
            • seqadmin
              Strategies for Sequencing Challenging Samples
              by seqadmin


              Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
              03-22-2024, 06:39 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by seqadmin, 04-11-2024, 12:08 PM
            0 responses
            18 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 04-10-2024, 10:19 PM
            0 responses
            22 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 04-10-2024, 09:21 AM
            0 responses
            17 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 04-04-2024, 09:00 AM
            0 responses
            49 views
            0 likes
            Last Post seqadmin  
            Working...
            X