Hi,
I'd appreciate some advice on processing some Illumina libraries
Initial FastQC runs showed the data as not great. I've used cutadapt to trim off adapters and FastQC shows improvements to all libraries.
One remains of concern, because it still retains kmer and other issues (I've attached files for kmer content & per base sequence content for both the original and the processed data)
My question is simple: is this good enough? (my next step is assembly with velvet) Does this data need some further processing before Velvet? If so, with what? I've considered trimming off the first 10nuc to remove the anomalous per_base_sequence_content trace, but that would do little for the persistent kmers.
If this were your data, what would you do before velvet assembly?
thanks
mgg
for the record my cutadapt commands are below
I'd appreciate some advice on processing some Illumina libraries
Initial FastQC runs showed the data as not great. I've used cutadapt to trim off adapters and FastQC shows improvements to all libraries.
One remains of concern, because it still retains kmer and other issues (I've attached files for kmer content & per base sequence content for both the original and the processed data)
My question is simple: is this good enough? (my next step is assembly with velvet) Does this data need some further processing before Velvet? If so, with what? I've considered trimming off the first 10nuc to remove the anomalous per_base_sequence_content trace, but that would do little for the persistent kmers.
If this were your data, what would you do before velvet assembly?
thanks
mgg
for the record my cutadapt commands are below
PHP Code:
# trim reads/2
cutadapt -b AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --minimum-length=10 --overlap=4 --quality-base=64 --quality-cutoff=3 --match-read-wildcards infile_2.fq -o processed/outfile_2.fq --wildcard-file=processed/outfile_2.fq.wildcard
# trim reads/1
cutadapt -b GATCGGAAGAGCACACGTCTGAACTCCAGTCAC --minimum-length=10 --overlap=4 --quality-base=64 --quality-cutoff=3 --match-read-wildcards infile_1.fq -o processed/outfile_1.fq --wildcard-file=processed/outfile_1.fq.wildcard
Comment