View Single Post
Old 01-29-2019, 04:50 AM   #3
phleroy
Junior Member
 
Location: Toulouse, France

Join Date: Jan 2019
Posts: 4
Default

Thank you very much for this suggestion
We do have the possibility to obtain a fastq file with quiver with the option -o out.fastq as you have mentionned for arrow

The question, is then, how you recover the mean QV for the consensus?

into the fastq file we can see :
@000000F|quiver
ATCATTGTTACTACTAGAGGAAGAATCTTTCTTG ...
+
"RQQPQQQRQQQQQSRRQSTSSQRQRSSSRRRQQRSRRRQRSRQ ...

I guess the quality value for each consensus nucleotide is the second line ? but how to calculate it ?

Thank you again for any help
Philippe
phleroy is offline   Reply With Quote