View Single Post
Old 08-17-2015, 05:05 PM   #1
arkilis
Senior Member
 
Location: Australia

Join Date: Jul 2013
Posts: 119
Default why Hairspin region will affect the PCR product

Hi,

I am doing a primer design recently, and using the primer 3 to do the primer design. But get a warning at the end:

CGGCGCCGAGCCCCGCCGGGGTGAGCTGGG


Which looks like a CGG Hairspin. Many people tell me that *might* cause the pcr amplification failure. But why...

Thanks in advance.
arkilis is offline   Reply With Quote