View Single Post
Old 11-23-2015, 05:33 AM   #1
xiangwulu
Member
 
Location: ireland

Join Date: Apr 2014
Posts: 18
Default Non A T G C base in RefSeq zebrafish mRNA sequence

I found some non A T C G base in refseq zebrafish mRNA sequence:
'Y', 'K', 'R', 'M', 'W'

couldn't find out what do they mean.

e.g.
NM_001012366.1
http://www.ncbi.nlm.nih.gov/nuccore/...5?report=fasta
at line:
CCCCCACAGTCCCTGCATTACGGGAATGTGCAGGCAAGAGGAAGCGGTCTCAGGGAGAGGAGGMCGAAGG

this is causing error for some alignment tool, such as bfast.

Thanks.

Last edited by xiangwulu; 11-23-2015 at 05:34 AM. Reason: typo
xiangwulu is offline   Reply With Quote