View Single Post
Old 06-13-2013, 03:17 AM   #1
ElenaN
Junior Member
 
Location: Moscow, Russia

Join Date: Nov 2012
Posts: 8
Default bwa mem segfault; bwa bwasw breaks MarkDuplicates

Hi,
I have run into various problems with various versions of bwa
1. bwa mem gives a segmentation fault right away. Not sure how to debug that, no matter what memory (we have 48G) and thread settings. Has anyone else run into this problem?
The call to bwa is
bwa-0.7.5a/bwa mem -M -R "@RG\tID:$ID\tLIB:SeqCapEZ.v3\tID:$ID\tPL:ILLUMINA" -t 24 ucsc.hg19.fasta $READS1 $READS2 > $ALN_OUT.sam

2. bwasw produces a file which does no work with MarkDuplicates.
The call to bwa is
/old_home/enabieva/bwa-0.7.5a/bwa mem -M -R "@RG\tID:$ID\tLIB:SeqCapEZ.v3\tID:$ID\tPL:ILLUMINA" -t 24 ucsc.hg19.fasta $READS1 $READS2 > $ALN_OUT.sam

The MarkDuplicates error is:
Exception in thread "main" net.sf.picard.PicardException: Value was put into PairInfoMap more than once. 1: null:HWI-ST992:135:C0YGDACXX:2:1108:12651:98485

Grepping for that read brings up the following:
HWI-ST992:135:C0YGDACXX:2:1108:12651:98485 113 chr1 564775
0 43S47M chr2 55113029 0TATCGTC
ACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATTACAATCTCCAGCATTCCCCCTCAAACCTAAGAAATATG
@DDDDEDBDDDDCCDFFFFFEGHHHGHIIGII
HJIIGGFGAGEGGBJIIGHFBJJGEHHJGGGCIIIJJJIGGIIHHHFFHHFDFDD@@@
AS:i:47 XS:i:47 XF:i:1 XE:i:1 NM:i:0
HWI-ST992:135:C0YGDACXX:2:1108:12651:98485 113 chr1 566621
0 51M39S chr2 55113029 0TATCGTC
ACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATTACAATCTCCAGCATTCCCCCTCAAACCTAAGAAATATG
@DDDDEDBDDDDCCDFFFFFEGHHHGHIIGII
HJIIGGFGAGEGGBJIIGHFBJJGEHHJGGGCIIIJJJIGGIIHHHFFHHFDFDD@@@
AS:i:51 XS:i:51 XF:i:1 XE:i:1 NM:i:0
HWI-ST992:135:C0YGDACXX:2:1108:12651:98485 145 chr2
55113029 168 90M * 0 0TGAGCCA
CCACGTCCAGCCCACTTTTTGATTTTCAAAGAGTCAGAGCCCCAAAATTCCATCTCTTCCTTGCCTCTCATCGTAGGGTTCAC
A:<?@<,8<=DBA@@?==3;;BBFEE>HEEEH
CAHG@HFFEEEE<GIGIIGHGJJIHF>BIIEIIHGJIIIGGCFD?HDGGGFDDFF@@@
AS:i:90 XS:i:0 XF:i:3 XE:i:2 NM:i:0

So it seems that the problem is that the first read is mapped twice, but this is not marked in any way.

I found a discussion of this problem, but the suggested solution seems roundabout.
Does anyone else encounter this?

Thanks,
Elena

Last edited by ElenaN; 06-13-2013 at 03:24 AM. Reason: bad hyperlink format
ElenaN is offline   Reply With Quote