View Single Post
Old 09-18-2008, 07:13 PM   #7
dandestroy
Junior Member
 
Location: Boston

Join Date: Jul 2008
Posts: 3
Default

Sorry for the small font, but that's the only way I could make it fit


Paired-end DNA

PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'
PE PCR Primer1:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE PCR Primer2:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
Result Library:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCGGTTCAG CAGGAATGCCGAGACCGATC TCGTATGCCGTCTTCTGCTT G 3'
3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
PE DNA Sequencing Primer1
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE DNA Sequencing Primer2
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGC--- -------------------- - 5'

Last edited by dandestroy; 09-18-2008 at 07:22 PM.
dandestroy is offline   Reply With Quote