View Single Post
Old 04-07-2008, 07:53 AM   #1
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,352
Default Illumina/Solexa Genome Analyzer Primer/Adapter Sequences

The following sequences were obtained from here (**):

Sequences for Solexa Library Preparations:

Genomic DNA oligonucleotide sequences

Adapters 1
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

PCR Primers 1
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT

Genomic DNA Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT


DpnII gene expression oligonucleotide sequences

Gex Adapter 1
5' P-GATCGTCGGACTGTAGAACTCTGAAC
5 ACAGGTTCAGAGTTCTACAGTCCGAC

Gex Adapter 2
5' CAAGCAGAAGACGGCATACGANN
5' P-TCGTATGCCGTCTTCTGCTTG

Gex PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Gex PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Gex Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

NlaIII gene expression oligonucleotide sequences

Gex Adapter 1
5' P-TCGGACTGTAGAACTCTGAAC
5' ACAGGTTCAGAGTTCTACAGTCCGACATG

Gex Adapter 2
5' CAAGCAGAAGACGGCATACGANN
5' P-TCGTATGCCGTCTTCTGCTTG

Gex PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Gex PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Gex Sequencing Primer
5' CCGACAGGTTCAGAGTTCTACAGTCCGACATG


Small RNA oligonucleotide sequences

RT Primer
5' CAAGCAGAAGACGGCATACGA

5' RNA Adapter
5' GUUCAGAGUUCUACAGUCCGACGAUC

3' RNA Adapter
5' P-UCGUAUGCCGUCUUCUGCUUGUidT

Small RNA PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Small RNA PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Small RNA Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

**disclaimer blah blah blah. We take no responsibility if you blow a flow cell using these sequences!
ECO is offline   Reply With Quote