Thread: SNP calling
View Single Post
Old 05-08-2013, 02:34 AM   #10
rob123king
Junior Member
 
Location: cranfield

Join Date: Feb 2013
Posts: 9
Default

Anyone know how I can do snp calling using a draft reference which is a series of contigs, example head below. I can do it using BWA-MEM and mpileup with a complete reference but using this draft I get almost no data. I think theres an issue with alingment to the draft reference as it is not a series of continuous data, maybe if i use some program to put them all together and fill in the gaps with N's or do the contigs just need renaming? Little lost how could use this draft genome, may just end up comparing against a more distant but complete genome.

>contig:unspecified:411:1:710:1 contig 411
GTTAGTGCCTACTGCCTCTTTTTCATCTGCCTGAATATCTCTCATCTTTCGTTATCCTTA
ATTGTCCTCATATCTTTCGATTATTTGTCAGGTTTTTGAGTATTAGGTGCTTATTCTTTA
AAAAATACACAGAAAGTTTATCGAAATGCTGCATTTAATCGTATTGTATATGAATACGCA
TTCTCTAACTGGTAAATGTATTGTACGAAAGAATTGTGTCTCAATGAAGTAAGTGGTTAT
CTCTGGTGTTAAGTTGGTGAGTATTTGTTGAATATTGATATTAATACCAGCAAATTGGAA
GTGATATTGAGTAAATGTTGGGATAGTAGTAAAGAGAAAGAACTTCGGTGTATAAGCGAA
AACTTCATTTAACCGTTAACAATACGATGGAAATAAGCACATGAAAATAATCTCATTTCC
TAGAATAGAGTCAGATTACTTGCTATTCTTAATTGTTGTTTCAAATGAAGTAGTACTAAC
TACTAACTACAGTAGAAATTGCAATATAATTTCCACTCTCCCTTGTGGAATTGGTAATTT
TGTGAGGGTAATATTAATATGCTTTGCTGCTCCTTAATAAAAATCAAACCATCAACTCTA
CCAAAATTAGTTGGGGTCAGTGATAGGAATTAATATTAGGTTATTTTTTGAAAACATAAT
GTATACACGGAAAGTGAGGAGAAAAAGGACAGGGGAATACAATATGGGAA
>contig:unspecified:586:1:3978:1 contig 586
TATATTTGCCTCATAAGAATGGGCCTATGGGCAAAAATGGGTTGGTCCAGATTGGGCTTT
TATTTATTTACATAGGAAGGGAAAAAGGCCCATAACCCAACAATTTTAACACCACATTCA
TTTACAAATCTACCCATTTGACCGAATCGACTTTTTTTCTTTTCATGTTCTTCTTCTCTC
AAGATAATTTAATTTATGATATTATCACAGTAAAATAAAAATTACTAAAATCTCACGCCG
TTTGCCCATTTTACAAACAAATTATATATCTTGTTGATTTAAATAAAAAAGAGATATATT
TAGATTAATAAATATAAAAGATAACGTAAATTTGTGTCATTTTATAATGAAAGGGGCATA
TATGAATTCAAAATATATTGAAAGGAATGTATTTAGATAAAAAAATATAGCGAAGGGTAT
rob123king is offline   Reply With Quote