View Single Post
Old 02-08-2010, 11:36 PM   #4
yasu
Member
 
Location: Japan

Join Date: Jul 2009
Posts: 10
Default

Thanks for your kind help!!

My fastq file is something like this. I omitted the sequence+position id from the line after "+". Does this make the things bad?

-Yasu

###########
@HWI-EAS368:1:1:9:316#0/1
CTGGATGATAACATTCCAGAAGATGACTCAGGTGTCCCCACCC
+
BB66AB9ACBB@BCBAAA><BBBAAB?BBB@@@BA?B@BB@AB
@HWI-EAS368:1:1:9:424#0/1
CTCCCTGCCAGATATCGAGGAGGTGAAAGACCAGAGCAGGAAC
+
BCBBB>?>@CBABBB;A877??.:<<B@;@@?=>?A>?6AAA?
@HWI-EAS368:1:1:9:1060#0/1
TGGATGGTTCAGGATAATCACCTGAGCAGTGAAGCCAGCTGCT
+
BBBBB=?@BBB?=@A9AA@CAA><<@:5>7?=A?A@?=A???@
@HWI-EAS368:1:1:9:410#0/1
CGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAGCTTCACCCG
+
AA9AAA=:A7'=7=?4+366=AA@:A>999B:=2,=>1014>7
@HWI-EAS368:1:1:9:807#0/1
CGAACATTTCTGGCCCCCAAGTGTCAGCCCATTCACGTAAAAA
+
BBBBBBC@@<:;6BC>:@2<B=BBB@7;BB=:C@799:BBB?%
@HWI-EAS368:1:1:9:405#0/1
TGTAAAGCCTGAAACAGCTGCCTGTGTGGGACTGAGATGCAGG
+
?=>B=AA@AB@AAB?88>@@@BB>?B>A<=>?A81<-<@@B@@
yasu is offline   Reply With Quote