View Single Post
Old 01-31-2019, 04:28 AM   #1
m.a.celik
Junior Member
 
Location: Turkey

Join Date: Jan 2019
Posts: 3
Default Extract Seq from Primers on BBDuK

Hello guys, a newbie in here.

I have reads from nanopore, converted fast5 files into fastq, what i am trying to do is extract the sequences between the primers. I attempt to do it by bbduk from BBMap.

First I tried this

Code:
./bbduk.sh in=/home/celik/Downloads/deneme/2/first0.fastq out=/home/dnacoder/Downloads/deneme/2/cikis.fasta literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA
which gave me an error saying "Error: Could not find or load main class jgi.BBDukF"

Then I searched and tried this running this code

Code:
java -ea -Xmx1g -cp /home/celik/Downloads/BBMAP/BBMap-master/sh/current/jgi.BBDuKF in=first0.fastq out=cikis.fastq literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA
then it gave me an error that read "Could not find or load main class in=first0.fastq"

Can anyone tell me what am I doing wrong, i ve looked on google and tried couple of things such as "export CLASSPATH=$CLASSPATH:." but did not make any change.

Thanks in advance.
m.a.celik is offline   Reply With Quote