View Single Post
Old 01-09-2020, 11:45 PM   #2
SNPsaurus
Registered Vendor
 
Location: Eugene, OR

Join Date: May 2013
Posts: 523
Default

I just tried your code on a test set with a random kmer in the 3rd read in bold

Code:
@NGSNJ-086:222:GW191226409th:1:1103:5556:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
ACTCAAAAACTTTGCTTTCTCAACATTCACCTAAGTCTACATTAAAATTCTTGCATCTTCTAACTCGTGTTCGCTAAGTAATGAAGCATCGTTTATTCAACACTTTTTTTTTACCTAATGGAACTAATTAATTATGTTTATCTTTCTTTG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFF:F:FFFF:FFFFFF
@NGSNJ-086:222:GW191226409th:1:1103:5900:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
GTCCAACACATCAAGGAGTGATTGATGTGAAATGGGTATTTAGGAACAAAAAGGATGAAAATGCTGAAATAATCGGAAATAAGGCAAGATTAGTTGCCAAAGGTTACTGTCAACAAGAATGGATAGACTATGATGAGACCTATGCTCCAG
+
FFFFFFFFFFFFF,FF:FFFF::FFFFFFFFFFFFFF:FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF
@NGSNJ-086:222:GW191226409th:1:1103:5990:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
GTGTACGAATTTCACATTATCGAAAATCTCATTTGTTTGGAAACATTTCCTCTTGGTGTCTTCGAACATGTAAGAAATGTAAAATTCATACCAAAATCGGGTAAGAATTTCATAATTATATAAGTATATGGTTATTGGTATGAATATAAT
+
FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF
bbduk.sh in=test.fq literal=GTCTTCGA ktrim=l k=8 rcomp=f out=test_out.fastq
Input: 3 reads 450 bases.
KTrimmed: 1 reads (33.33%) 65 bases (14.44%)
Total Removed: 0 reads (0.00%) 65 bases (14.44%)
Result: 3 reads (100.00%) 385 bases (85.56%)

cat test_out.fastq
Code:
@NGSNJ-086:222:GW191226409th:1:1103:5556:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
ACTCAAAAACTTTGCTTTCTCAACATTCACCTAAGTCTACATTAAAATTCTTGCATCTTCTAACTCGTGTTCGCTAAGTAATGAAGCATCGTTTATTCAACACTTTTTTTTTACCTAATGGAACTAATTAATTATGTTTATCTTTCTTTG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFF:F:FFFF:FFFFFF
@NGSNJ-086:222:GW191226409th:1:1103:5900:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
GTCCAACACATCAAGGAGTGATTGATGTGAAATGGGTATTTAGGAACAAAAAGGATGAAAATGCTGAAATAATCGGAAATAAGGCAAGATTAGTTGCCAAAGGTTACTGTCAACAAGAATGGATAGACTATGATGAGACCTATGCTCCAG
+
FFFFFFFFFFFFF,FF:FFFF::FFFFFFFFFFFFFF:FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF
@NGSNJ-086:222:GW191226409th:1:1103:5990:31187 1:N:0:GAAGCGGCAC+CGGCTCTACT
ACATGTAAGAAATGTAAAATTCATACCAAAATCGGGTAAGAATTTCATAATTATATAAGTATATGGTTATTGGTATGAATATAAT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF
So it worked on my set. Can you set outm= and look at what is being removed?

You could also try kmask=# to see if it is finding the kmer desired.
__________________
Providing nextRAD genotyping and PacBio sequencing services. http://snpsaurus.com
SNPsaurus is offline   Reply With Quote