Thread: subread
View Single Post
Old 06-06-2013, 10:10 PM   #14
Jon_Keats
Senior Member
 
Location: Phoenix, AZ

Join Date: Mar 2010
Posts: 279
Default

Hi Wei,

Got a new bug during SAM->BAM conversion using samtools:
Code:
[samopen] SAM header is present: 178 sequences.
Parse error at line 580: sequence and quality are inconsistent
I pulled out the lines 579-581, and what you see is that it didn't print the quality values for some reason
Code:
HWI-ST388-W7D:30:D25DKACXX:2:1101:11621:1970	217	MT	7312	199	100M	*	0	0	TCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCATAAACCTGGAGTGACTATATGGATGCCCCCCACCCTACCA	CDDDDCDDEDDDDDBDDDDDDDDDDDDDDDCDDDDDDDEEEEDEDDDCCCDB<DDBCDDDCDC@DDDDDDDEEEDEDDDDDDDDDDJHHHD=FFEDBCB@
HWI-ST388-W7D:30:D25DKACXX:2:1101:11726:1975	165	*	0	0	*	MT	7312	0	TAAAAATACAAAAATTAGCCAGGCTTGGTGGCGGGAGCCTGTAATCCCAGCTACTTGGGAGGCTGAGGCATGAGAATCACTTGAACCGGGGAGGTGGAGG	
HWI-ST388-W7D:30:D25DKACXX:2:1101:11726:1975	69	*	0	0	*	22	23243225	0	CTTGATCTTTGCTCACTGCAACCTCCACCTCCCCGGTTCAAGTGATTCTCATGCCTCAGCCTCCCAAGTAGCTGGGATTACAGGCTCCCGCCACCAAGCC	JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
I checked through the file and found that 2.9% of the lines written to the SAM file are missing the quality values

Some other examples
Code:
HWI-ST388-W7D:30:D25DKACXX:2:1101:11989:2774	133	*	0	0	*	22	23029478	0	GCGCGGGGATCCCTGACGATCTCTCACTGTCTTTATGTATCACCAAAACAGGGGCCTGGCCTGGCTTCTGTTGATACCAAAAAGTGTATTGTCTTGCCAA	
HWI-ST388-W7D:30:D25DKACXX:2:1101:12573:2770	165	*	0	0	*	1	179051348	0	CGTCTTCTGCCTGGACTCCACTGATGGTCAAAGTGACTGTTGTCCCTGAAGTGGAGCCTGAGAATCGCGCGGGGATCCCTGACGATCTCTCACTGTCTTT	
HWI-ST388-W7D:30:D25DKACXX:2:1101:12678:3000	141	*	0	0	*	*	0	0	CCAGCATTTTGGGAGGCCAAGGTGGGCAGATCACCTGAGGTCAGGAGTTTGAGACCAGCCTGGCCAACATGGAGAAATCCCGTCTCTACTAAAAATACAA	
HWI-ST388-W7D:30:D25DKACXX:2:1101:13149:2807	165	*	0	0	*	22	23243223	0	ACGAGGCTGACTATTATTGTCAATCAGGAGACAGCAGTACCTGGGTCTTCGGCGGAGGGACCAGGCTGACCGTCCTGAGTCAGCCCAAGGCTGCCCCCCC	
HWI-ST388-W7D:30:D25DKACXX:2:1101:14167:2974	141	*	0	0	*	*	0	0	CAAGACAATACACTTTTTGGTATCAACAGAAGCCAGGCCAGGCCCCTGTTTTGGTGATACATAAAGACAGTGAGAGATCGTCAGGGATCCCCGCGCGATT	
HWI-ST388-W7D:30:D25DKACXX:2:1101:16334:2859	133	*	0	0	*	8	126448195	0	CGAAGTGGAGCCTGAGAATCGCGCGGGGATCCCTGACGATCTCTCACTGTCTTTATGTATCACCAAAACAGGGGCCTGGCCTGGCTTCTGTTGATACCAA	
HWI-ST388-W7D:30:D25DKACXX:2:1101:19005:2869	165	*	0	0	*	22	23090325	0	AACGTCTTCTGCCTGGACTCCACTGATGGTCAAAGTGACTGTTGTCCCTGAAGTGGAGCCTGAGAATCGCGCGGGGATCCCTGACGATCTCTCACTGTCT	
HWI-ST388-W7D:30:D25DKACXX:2:1101:19233:2985	133	*	0	0	*	12	25403108	0	TCCAGCTACTCAGGAGGCTGAGGCAGGAGAATTGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGCTGAGATGGCACCATAGCACTCCAGCCTAGGCGAC	
HWI-ST388-W7D:30:D25DKACXX:2:1101:19566:2846	165	*	0	0	*	15	45007689	0	GCAATGGCGTGATCTTGGCTCACCACAACCTCCGCCTCCCGGGTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGCATGTGCCA	
HWI-ST388-W7D:30:D25DKACXX:2:1101:19762:2931	133	*	0	0	*	22	23248677	0	TCTGGAGATGCATTGGCAAGACAATACACTTTTTGGTATCAACAGAAGCCAGGCCAGGCCCCTGTTTTGGTGATACATAAAGACAGTGAGAGATCGTCAG	
HWI-ST388-W7D:30:D25DKACXX:2:1101:20141:2998	141	*	0	0	*	*	0	0	AGGGGGCAGCCTTGGGCTGACTCAGGACGGTCAGCCTGGTCCCTCCGCCGAAGACCCAGGTACTGCTGTCTCCTGATTGACAATAATAGTCAGCCTCGTC	
HWI-ST388-W7D:30:D25DKACXX:2:1101:1551:3119	165	*	0	0	*	22	23243487	0	CTCCACTGATGGTCAAAGTGACTGTTGTCCCTGAAGTGGAGCCTGAGAATCGCGCGGGGATCCCTGACGATCTCTCACTGTCTTTATGTATCACCAAAAC	
HWI-ST388-W7D:30:D25DKACXX:2:1101:2045:3173	165	*	0	0	*	11	118309802	0	CCTGAAGTGGAGCCTGAGAATCGCGCGGGGATCCCTGACGATCTCTCACTGTCTTTATGTATCACCAAAACAGGGGCCTGGCCTGGCTTCTGTTGATACC	
HWI-ST388-W7D:30:D25DKACXX:2:1101:2296:3207	133	*	0	0	*	6	7891857	0	TACACTTTTTGGTATCAACAGAAGCCAGGCCAGGCCCCTGTTTTGGTGATACATAAAGACAGTGAGAGATCGTCAGGGATCCCCGCGCGATTCTCAGGCT	
HWI-ST388-W7D:30:D25DKACXX:2:1101:2861:3094	165	*	0	0	*	MT	8025	0	AGACAGTGAGAGATCGTCAGGGATCCCCGCGCGATTCTCAGGCTCCACTTCAGGGACAACAGTCACTTTGACCATCAGTGGAGTCCAGGCAGAAGACGAG	
HWI-ST388-W7D:30:D25DKACXX:2:1101:12366:3168	165	*	0	0	*	1	565136	0	CCTTGGGCTGACTATTATTGTCAATCAGGAGACAGCAGTACCTGGGTCTTCGGCGGAGGGACCAGGCTGACCGTCCTGAGTCAGCCCAAGGAGATCGGAA	
HWI-ST388-W7D:30:D25DKACXX:2:1101:12388:3239	165	*	0	0	*	19	41813306	0	CTGGACTCCACTGATGGTCAAAGTGACTGTTGTCCCTGAAGTGGAGCCTGAGAATCGCGCGGGGATCCCTGACGATCTCTCACTGTCTTTATGTATCACC	
HWI-ST388-W7D:30:D25DKACXX:2:1101:13339:3182	165	*	0	0	*	7	5568181	0	CAGAAGCCAGGCCAGGCCCCTGTTTTGGTGATACATAAAGACAGTGAGAGATCGTCAGGGATCCCCGCGCGATTCTCAGGCTCCACTTCAGGGACAACAG	
HWI-ST388-W7D:30:D25DKACXX:2:1101:13684:3121	165	*	0	0	*	4	3534046	0	GCAGAAGCCTCAGGAGCCGATGCGATCAACTGGAAGAAAGGGTATCAGCAATGGAAGATGAAATGAATGAAATGAAGCGAGAAGGGAAGTTTAGAGAAAA	
HWI-ST388-W7D:30:D25DKACXX:2:1101:16067:3233	165	*	0	0	*	19	39125643	0	CTCCACTGATGGTCAAAGTGACTGTTGTCCCTGAAGTGGAGCCTGAGAATCGCGCGGGGATCCCTGACGATCTCTCACTGTCTTTATGTATCACCAAAAC
Jon_Keats is offline   Reply With Quote