View Single Post
Old 08-02-2016, 10:14 AM   #1
emacalate
Junior Member
 
Location: Cleveland

Join Date: Dec 2014
Posts: 1
Question ATAC-seq (Read1/Read2/Index Sequencing Primers?)

Hi,

We recently prepared samples for ATAC-seq using primers from the Buenrostro et al paper.

Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
Ad2.1 CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT

Does anyone know the Read1/Read2/Index primers to use to read out sequences from ATAC-libraries on the Illumina sequencer (for paired end sequencing)? Are these custom primers?

I was told to use Nextera sequencing primers, but I can't figure out how these work for ATAC-libraries. Maybe I have the wrong sequences downloaded?

Any help would be greatly appreciated!

Thanks,

Steve
emacalate is offline   Reply With Quote