Hi all,
I am looking for the exact sequence for the default MiSeq Index Primer. Can anyone help me to check if this is the correct one?
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
and probably provide me if there is any reliable source where Illumina
confirms this is the correct sequence?
Thank you very much.
Merry Christmas.