View Single Post
Old 03-26-2013, 10:50 AM   #8
JenBarb
Member
 
Location: Bethesda, MD

Join Date: Oct 2010
Posts: 47
Default

Here is the command I used:
htseq-count -s reverse -q 22all_sort.sam ./../igenome.mm10.mouse.genes.gtf > 22all.counts 2> error.log
------------------------------------------------------------------------------
the igenomes file first 10 lines:
chr1 unknown exon 3214482 3216968 . - . gene_id "Xkr4"; transcript_id "NM_001011874"; gene_name "Xkr4"; p_id "P2638"; tss_id "TSS25343";
chr1 unknown stop_codon 3216022 3216024 . - . gene_id "Xkr4"; transcript_id "NM_001011874"; gene_name "Xkr4"; p_id "P2638"; tss_id "TSS25343";
chr1 unknown CDS 3216025 3216968 . - 2 gene_id "Xkr4"; transcript_id "NM_001011874"; gene_name "Xkr4"; p_id "P2638"; tss_id "TSS25343";
chr1 unknown CDS 3421702 3421901 . - 1 gene_id "Xkr4"; transcript_id "NM_001011874"; gene_name "Xkr4"; p_id "P2638"; tss_id "TSS25343";
chr1 unknown exon 3421702 3421901 . - . gene_id "Xkr4"; transcript_id "NM_001011874"; gene_name "Xkr4"; p_id "P2638"; tss_id "TSS25343";
chr1 unknown CDS 3670552 3671348 . - 0 gene_id "Xkr4"; transcript_id "NM_001011874"; gene_name "Xkr4"; p_id "P2638"; tss_id "TSS25343";
chr1 unknown exon 3670552 3671498 . - . gene_id "Xkr4"; transcript_id "NM_001011874"; gene_name "Xkr4"; p_id "P2638"; tss_id "TSS25343";
chr1 unknown start_codon 3671346 3671348 . - . gene_id "Xkr4"; transcript_id "NM_001011874"; gene_name "Xkr4"; p_id "P2638"; tss_id "TSS25343";
chr1 unknown exon 4290846 4293012 . - . gene_id "Rp1"; transcript_id "NM_001195662"; gene_name "Rp1"; p_id "P10825"; tss_id "TSS5726";
chr1 unknown stop_codon 4292981 4292983 . - . gene_id "Rp1"; transcript_id "NM_001195662"; gene_name "Rp1"; p_id "P10825"; tss_id "TSS5726";
------------------------------------------------------------------------------

the first ten lines of my sorted sam file:
D192UACXX:6:1101:01077:12646 99 chr15 64254176 50 101M = 64254179 104 CCTNCTCCCATGCTCCTATCATCCCTTCTATCATCCTCTTCCCTACTCGACATTCTTCATAGCACCTTTCACACTACTGCCTGAGTGCTTATTTGCTTGAN C@C#4ADDHFFHFIIJIIJJJJIJJJJIHHIBGIGJJIJJDHJIIIFIJIGGIIGIJJGIJJIJIFGIJIGIHEE>ED@DEFDAECACEDCACD5;CC### AS:i:-2 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:3A96T0 YT:Z:UU NH:i:1 XS:A:-
D192UACXX:6:1101:01077:12646 147 chr15 64254179 50 101M = 64254176 -104 NCTCCCATGCTCCTATCATCCCTTCTATCATCCTCTTCCCTACTCGACATTCTTCATAGCACCTTTCACACTACTGCCTGAGTGCTTATTTGCTTGATTTC ###A93CA99>CC;C@?C=A?7DFDCHCE?9HEDC;@IGCB8:?IHDFB?99*@AGHEIJIIIHDAEGHF<EFIIIGA;JIIIIIFIIHDHD8FFFFF@@@ AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:0A100 YT:Z:UU NH:i:1 XS:A:-
D192UACXX:6:1101:01077:13595 163 chr9 64889674 50 58M3554N43M = 64889728 3709 GCACAGTTCAAAAGAGCTTTGAAGAAACATCCACACTTACCACAGACAGCGCTCTCAGGTGGCCGGTCTGATCTTGGATATAATTCATTATCTAAGGACAN BC@FFDDFHGHHHJHIJJJIJIGHIIJIJJHIJJJIIJJJJJJJJJIJJGGHHJJJGJJFGGIIHHDDDECDEDDDDCDECDDEEDDEEEEDDDCCCDDC# AS:i:-1 XM:i:1 XO:i:0 XG:i:0 MD:Z:100A0 NM:i:1 XS:A:+ NH:i:1
D192UACXX:6:1101:01077:13595 83 chr9 64889728 50 4M3554N97M = 64889674 -3709 NCAGGTGGCCGGTCTGATCTTGGATATAATTCATTATCTAAGGACAATGTTAGAAGAGAGGGTCCATCTACTGAAGACATTCAAGGGGAAAAGGAGANAAG #CBBDDDB?<DFFDFFHHHHHFEJIGJJJJJJIJIJJJJJJJJJJJJJJJIJIJJJJJJHIIGJJJJIJJIIJJJJIJJJJJJJJJJJHHHHHDDA4#BB@ AS:i:-2 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:0T96A3 YT:Z:UU XS:A:+ NH:i:1
D192UACXX:6:1101:01077:19692 163 chr8 124880350 50 3M3003N98M = 124883444 3195 CTGATAACAAACTTCCTGAGGAAGTGGTCCAGTCCAGCATCCTCCTGCACTCTAACCTGGCCAGCCTTGTCAAAGACCAGGTGGTTCTGAAAATGAACTCN BBBFFFFFHHHHHJIJJJHIJIIJFHIHJJJJJJJJJJJJJJJIJJJIJJHIJHIJJJJJJJJJJJJJJJHHHHHHFFFFDACD@BDDDECDDDDDDDDC# AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:3 MD:Z:100T0 YT:Z:UU XS:A:+ NH:i:1
D192UACXX:6:1101:01077:19692 83 chr8 124883444 50 101M = 124880350 -3195 NATGAACTCTGGAAGCTCACAAGTGGTCAACGGGCTTGTGCCCGAACATATCGCCCTCCTCATGTGCTCTGCCTACAGGAACCAGCTGCTCAACATTNTTG #AEDDADDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDCDFFHHHHJJIHFIIIJJIJJJJJJJJJJIJJJJJJJJJJJJJJJJJIJJHHHHHFDB4#CCC AS:i:-2 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:0A96T3 YT:Z:UU NH:i:1 XS:A:+
D192UACXX:6:1101:01077:35330 177 chr1 24612504 50 101M chrM 10022 0 NAAACTAAGATGGTGATGGGGATTGGTATGGAGCTTATGGAGTTGGAGTTTAGGGAAGTTACTGAAGTTATAATAAATAAGGATAATACTATGCCTTCCAG #EDDEEEEEEEFFFFFHHHHJJJJJJJJJJJJIIIGJJJJJJJIJJJJJIHIJJJJJJJJJJJJJJJJJJIJJJJJHHJJIJJHIHIHHFHHHFFFFFCCC AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:0A100 YT:Z:UU NH:i:1 XS:A:-
D192UACXX:6:1101:01077:35330 113 chrM 10022 50 101M chr1 24612504 0 NAAACTCCAACTCCATAAGCTCCATACCAATCCCCATCACCATCTTAGTTTTCGCAGCCTGCGAAGCAGCTGTAGGACTAGCCCTACTAGTAAAAGTNTCA #CC@C@DDCCDCDCDCDDCB>DDDCCDDDBADDEEC??;FFHEHHIJJJJIEJJJJGJJJJJJJJIJJJJJJIJJIIJIJHJIHJHIGHHHHHFDA4#CCC AS:i:-2 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:0T96T3 YT:Z:UU NH:i:1 XS:A:+
D192UACXX:6:1101:01077:50524 99 chr3 84160839 50 101M = 84160927 189 GTCNGGAATGGTGAGAAAGAACGTTAGCAGAGGGTACTGTGTTGATAGCACAACGTCCCACGTTATAAAGCAAAAGCATGAGGTTAAGGCTGTGTTGCTTN @CC#4AABDHHCFIHIIIJGJIJIIJIGJJJCHJ?DHHIIJIFHIIE@BGEFHIE@FHIJEECHHFEFFFEEDEEEBDDDDDD?AC>CCCDA?CCABD>@# AS:i:-2 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:3A96T0 YT:Z:UU NH:i:1 XS:A:-
D192UACXX:6:1101:01077:50524 147 chr3 84160927 50 101M = 84160839 -189 NCTGTGTTGCTTTCAAAAGTTAATGGAAGTGCTGTACATTCATTGGAACAACATAGCTGATTATTAATCTCTTCTAGAATACTAATGAATCGCATCCATAC #BDDEADEEFCDBFGHHEEECJJIIGJIJGGIIHDFFHGGJJJIEHAGHGJJIIHEGDAGCIHD>DHIJJHIGHIIGJIHFFIIIHJIHHHHHFFEDD@B@ AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:0G100 YT:Z:UU NH:i:1 XS:A:-
------------------------------------------------------------------------------
the program has been running for about 2 hours and the output directory files real time snapshot:
-rw-r--r-- 1 barbj MSCL 60566222168 Mar 26 12:37 22all_sort.sam
-rw-r--r-- 1 barbj MSCL 0 Mar 26 12:45 22all.counts
-rw-r--r-- 1 barbj MSCL 0 Mar 26 12:45 error.log
JenBarb is offline   Reply With Quote