View Single Post
Old 01-11-2011, 01:28 PM   #7
amango
Member
 
Location: New York

Join Date: Dec 2009
Posts: 17
Default problems with indexed paired-end mRNA-seq

JMorlan, gford, josdegraaf and anyone else,
I am working on a 'homemade' paired-end indexed mRNA-seq protocol. I am having trouble amplifying my adapter-ligated library (or maybe I'm having trouble with ligation). Would you be willing to send me your protocol and adapter & PCR sequences?

I am using the following adapter sequences, derived from another SEQanswers post (http://seqanswers.com/forums/showpos...5&postcount=13). 6-bp index tags are denoted by NNNNNN.

PEMx1 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNN*T
PEMx2 5’-pnnnnnnAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG

I plan to ligate different unique-index adapter set to my different libraries. And then enrich all libraries with these universal primers:

PCR PE1 5’-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAAC CGCTCTTCCGATCT
PCR PE2 5' - AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA CGCTCTTCCGATCT

Am I correct that I do not need any PCR primers specific to my indexed adapters?

Any help would be appreciated!

Last edited by amango; 01-11-2011 at 03:29 PM. Reason: addressed too narrowly
amango is offline   Reply With Quote