View Single Post
Old 09-17-2019, 11:50 AM   #12
Manuelly
Junior Member
 
Location: Brazil

Join Date: Aug 2019
Posts: 7
Default

1.after extracting the consensus in fasta format, I opened fasta and came across this:
>E00382:156:HMFJCCCXX:1:1102:7659:38315/2
TTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGT
>E00382:156:HMFJCCCXX:1:1105:22019:53803/1
ATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCCCA
2.I think my fasta is separated by reads. and to solve this I used the following command:
for i in *.fa; do reformat.sh in1=$i in2=$i out=${i}.fa ; done
3. I believe it is not this command or something went wrong in the command. Can anyone help me?

I want uninterrupted fastas. it is possible?

Last edited by Manuelly; 09-17-2019 at 11:58 AM.
Manuelly is offline   Reply With Quote