View Single Post
Old 11-26-2019, 09:43 AM   #1
Tom2013
Member
 
Location: Canada

Join Date: Sep 2013
Posts: 19
Default Can I use default sequencing primers for Miseq?

I use below PCR primers to prepare libraries for Miseq amplicon sequencing:

i7-INDEX2-Spacer- gene_specific_Primer

CAAGCAGAAGACGGCATACGAGAT TCGCCTTA GTCTCGTGGGCTCGG +gene_specific_Primer

i5-INDEX2-Spacer+gene_specific_Primer
AATGATACGGCGACCACCGAGATCTACAC-CTCTCTAT-TCGTCGGCAGCGTC+gene_specific_Primer

Compared to Nextera adapters, my primers do not include the tagmentation sequence. I tried to look up Miseq sequencing primers, but still not sure whether my adapters are compatible with Miseq sequencing primers.

Can I use default sequencing primers in Miseq cartridge for sequencing? Does anybody know any website or document to verify that?
Tom2013 is offline   Reply With Quote