View Single Post
Old 01-18-2019, 01:24 AM   #137
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 614
Default

Trim Galore tries to identify read-through adapter contamination, which is the kind of contaminant that will prevent your sequences from aligning at all, or might even cause mis-alignments. For the standard Illumina adapter, this sequence always starts with AGATCGGAAGAGC...

It does not attempt to find or remove any other kind of contaminant or over-represented sequence, because they are normally not as harmful. E.g. an over-represented sequence such as ATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGGCCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA might be present in the library, but it will simply not align to a genome, thereby filtering itself out at the alignment stage.

Last edited by fkrueger; 01-18-2019 at 01:24 AM. Reason: typo
fkrueger is offline   Reply With Quote