Hi,
Does anyone know what negative bwa mapping quality means?
I am using the aligned data from 1000 genome project (I look at this sample NA12716.mapped.ILLUMINA.bwa.CEU.low_coverage.20101123.bam). For a properly mapped pair reads, I found that the mapping quality for one read is 226 and the other is -226. Does anyone know why?
When I do pileup in samtools, it excludes that read with negative mapping quality.
Here is that pair reads data:
ERR000573.12285810 pPR2 X 154402571 60 51M = 154402756 226 GATGCAATAAGAGATAAAGCTAGAGAGGTTAATAGAGGCCAGAACTCATAG =@%?>:@@?@>=>=@?A@>>@3>:=<=>:A>@@>=1=>;>929?>$>4@2> X0:i:1 X1:i:0 MD:Z:51 RG:Z:ERR000573 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
ERR000573.12285810 pPr1 X 154402756 60 9S42M = 154402571 -226 GCGAAGAAGTCAATTAGAAAGTCTTTTCAAGTTATCCAAGCAGGAGGTCTC 27=AA=8A;<?A?@>@>@@@=;>=<>>?A@>@>@:?>AA>?@>??>>=?9? X0:i:1 X1:i:0 XC:i:42 MD:Z:42 RG:Z:ERR000573 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
Thank you very much!!
Anney
Does anyone know what negative bwa mapping quality means?
I am using the aligned data from 1000 genome project (I look at this sample NA12716.mapped.ILLUMINA.bwa.CEU.low_coverage.20101123.bam). For a properly mapped pair reads, I found that the mapping quality for one read is 226 and the other is -226. Does anyone know why?
When I do pileup in samtools, it excludes that read with negative mapping quality.
Here is that pair reads data:
ERR000573.12285810 pPR2 X 154402571 60 51M = 154402756 226 GATGCAATAAGAGATAAAGCTAGAGAGGTTAATAGAGGCCAGAACTCATAG =@%?>:@@?@>=>=@?A@>>@3>:=<=>:A>@@>=1=>;>929?>$>4@2> X0:i:1 X1:i:0 MD:Z:51 RG:Z:ERR000573 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
ERR000573.12285810 pPr1 X 154402756 60 9S42M = 154402571 -226 GCGAAGAAGTCAATTAGAAAGTCTTTTCAAGTTATCCAAGCAGGAGGTCTC 27=AA=8A;<?A?@>@>@@@=;>=<>>?A@>@>@:?>AA>?@>??>>=?9? X0:i:1 X1:i:0 XC:i:42 MD:Z:42 RG:Z:ERR000573 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
Thank you very much!!
Anney
Comment