View Single Post
Old 03-24-2010, 04:31 AM   #46
cur
Junior Member
 
Location: aberdeen

Join Date: Dec 2009
Posts: 5
Default solexa adapter sequences for paired end data

Hi
I wonder if somebody can help me here....I have got some solexa data (paired end reads) and want to map these to the genome with bwa/maq...However when I did this only 20% of sequences mapped so I gather I want to check/ for presence of adapters in the sequences and then repeat the alignment after trimming of the data.

Which adapter sequences should I screen for- as this is paired end data I assume its the 5` to 3` sequence for the PE adpter 1 and 2 which I found in one of your posts?
Paired-end DNA

PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'

In fasta format:
>Solexa-PairedEndAdapter1
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>SolexaPairedEndAdapter2
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG

If I had single end solexa data would I then screen for the same adapters

Genomic DNA oligonucleotide sequences (from previous posting)
Adapters 1
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Last edited by cur; 03-24-2010 at 04:39 AM.
cur is offline   Reply With Quote