View Single Post
Old 03-24-2010, 07:42 AM   #47
greigite
Senior Member
 
Location: Cambridge, MA

Join Date: Mar 2009
Posts: 141
Default

Hi cur,

That is not quite right- you have to use the sequence of the PCR product produced by amplification of your library with paired end primers to identify sequences to screen out. You are looking for sequence between your insert and the flow cell oligo. This would appear in your product only if your insert was incredibly short (or nonexistent)- I suspect you may have sequenced a whole bunch of adapters. What did your Bioanalyzer trace look like? I've found that the molar ratio of amplified adapter sequence (~130 bp) to amplified library is pretty close to the percentage of adapter only reads you get.

I believe the following is right but others please correct if not:

Sequence between your insert and the flow cell oligo for Round 1 paired end:
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG

Sequence between your insert and the flow cell oligo for Round 2 paired end:
AGAAAGGGATGTGCTGCGAGAAGGCTAGA

For single read the appropriate sequence to screen out depends whether you prepped your libraries with single or paired end adapters.
greigite is offline   Reply With Quote