View Single Post
Old 09-16-2009, 12:58 PM   #41
haheller
Junior Member
 
Location: WI

Join Date: Sep 2009
Posts: 2
Default

New to this so my knowledge-base is still quite limited so be gentle in reply, please
We will prepare miRNA-Seq library and send it out for sequencing on a GAII. Can anyone confirm that these adapter/Primer sequences first reported by ECO have (can) been used successfully on the GAII (and presumably GAIIx)?

Small RNA oligonucleotide sequences
RT Primer
5' CAAGCAGAAGACGGCATACGA

5' RNA Adapter
5' GUUCAGAGUUCUACAGUCCGACGAUC

3' RNA Adapter
5' P-UCGUAUGCCGUCUUCUGCUUGUidT

Small RNA PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Small RNA PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Small RNA Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Was (is) there a GAI instrument? Does it require different Adapter/Primer sequences? Can't find any evidence of a GAI version on Illumina website.
Thanks in advance
haheller is offline   Reply With Quote